5 стол по певзнеру: Страница не найдена — Областное бюджетное учреждение здравоохранения «Городская клиническая больница №4»

Содержание

Стол номер 5: правила диеты для здоровья печени и желчного пузыря

https://ria.ru/20201224/dieta-1590764680.html

Стол номер 5: правила диеты для здоровья печени и желчного пузыря

Стол номер 5: правила диеты для здоровья печени и желчного пузыря — РИА Новости, 18.10.2021

Стол номер 5: правила диеты для здоровья печени и желчного пузыря

Стол номер 5 — рацион питания, разработанный еще в 1920-х годах. Когда его назначают и что он в себя включает — в материале РИА Новости. РИА Новости, 18.10.2021

2020-12-24T15:18

2020-12-24T15:18

2021-10-18T12:19

общество

продукты

питание

диета

витамины

здоровый образ жизни (зож)

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdnn21.img.ria.ru/images/154897/64/1548976425_0:100:1920:1180_1920x0_80_0_0_a5f8c1e54ca598dd96f34a4eae777f5b.jpg

МОСКВА, 24 дек — РИА Новости. Стол номер 5 — рацион питания, разработанный еще в 1920-х годах. Когда его назначают и что он в себя включает — в материале РИА Новости.Показания к применениюОсобая диета под названием «Стол №5» назначается специалистами людям с заболеваниями печени, желчевыводящих путей и желчного пузыря: холецистите, гепатите, желчнокаменной болезни. Также ее можно применять для общего оздоровления организма.Питание «по столам» разработал основатель диетотерапии, советский врач Мануил Певзнер. Его диеты являются лечебными или создают благоприятные условия для восстановления организма человека. Также они помогают избежать обострения болезней. Система русского врача активно применяется при лечении заболеваний в стационарах, санаториях. Также столы рекомендуют пациентам и вне стен лечебных учреждений.Всего система включает в себя 15 групп рационов. Диеты столов №1, 1а, 1б назначают при язве желудка и двенадцатиперстной кишки; диету стола №2 — при атрофическом гастрите, колитах; диету стола №3 — при запорах; диеты столов №4, 4а, 4б, 4в — при болезнях кишечника с диареей; диеты столов №5, 5а — при заболеваниях желчных путей и печени; диету стола № 6 — при мочекаменной болезни, подагре; диеты столов №7, 7а, 7б, 7в, 7г — при хроническом и остром нефрите, хронической почечной недостаточности; диету стола №8 — при ожирении; диеты стола №9 — при сахарном диабете; диету стола №10 — при заболеваниях сердечно-сосудистой системы; диету стола №11 — при туберкулезе; диету стола №12 — при заболеваниях нервной системы; диету стола №13 — при острых инфекционных заболеваниях; диету стола №14 — при болезни почек с отхождением камней из фосфатов; диету стола №15 — при заболеваниях, не требующих особых диет. Часто эти рационы питания называют столами ОВД. Аббревиатура расшифровывается как «основной вариант диеты». Цель диеты «Стол номер 5″При полноценном рационе диета стола 5 способствует снижению нагрузки на печень и желчевыводящую систему. Щадящее питание диеты «Стол №5» способствует нормализации работы желчных путей и печени, улучшает желчеотделение и налаживает обмен холестерина в организме. Общая характеристика диетыРацион диетического стола 5 включает в себя нормальное содержание белков и углеводов в меню, но ограниченное количество жира. Готовить блюда разрешается двумя способами — их нужно варить и запекать, правда, изредка можно тушить. Подавать готовую еду нужно только в теплом виде.Мясо и рыбу важно мелко рубить, делать из них фарш или суфле. Разрешены для 5 стола рецепты протертых овощных, молочных и крупяных супов. При этом они должны быть без мяса, рыбы и грибов. Масла можно использовать только в качестве заправок к блюдам, а молочные продукты следует выбирать с пониженной жирностью. Яйца допускается есть в ограниченном количестве, лучше всмятку или в составе омлета.Хлеб при диете стола 5 нужно употреблять вчерашний. Также можно включать в питание сухари или галеты. Из круп врачи рекомендуют гречку, овес, манку, рис. Кроме того, разрешаются макароны из твердых сортов пшеницы.Овощи можно отваривать, запекать, есть сырыми. Разрешается включить в меню 5 стола горошек, морковь, тыкву, свеклу, помидоры, огурцы, картофель, кабачки, цветную капусту. Овощи, богатые клетчаткой, важно перетирать.Из фруктов можно есть бананы, груши и некислые яблоки, а вот зелень и специи, грибы, чеснок, редис нужно ограничить.Из десертов разрешены желе, запеканки, пудинги, мед и сухофрукты. В ограниченном количестве можно есть пастилу, мармелад и варенье. Из напитков — травяные чаи, некрепкий черный и зеленый чай, соки, компоты, кисели.Запрещено употреблять острое, копченое, жареное, субпродукты, консервы, сало. Полностью исключаются из рациона соусы, газировка, спиртное, какао и черный кофе. Также нельзя шоколад, мороженое, клюкву, цитрусовые.Режим питанияВо время соблюдения диеты 5 стола обязательно пить много воды натощак. Питаться важно дробно — употреблять небольшие равные порции 5 -6 раз в день, через каждые 2,5-3 часа.Суточный рацион (энергетическая ценность и химический состав)Продукты и блюда, включенные в питание в сутки, должны содержать до 80 грамм белков (50% из которых животного происхождения), до 80-90 грамм жиров (30% из которых растительного происхождения), а также до 400 грамм углеводов. Кроме того, необходимо выпивать до 1,5-2 литров воды.Общая энергетическая ценность суточного рациона при диете «Стол №5» — примерно 2400 — 2800 килокалорий. При этом разрешается употреблять не более 10 грамм соли.Примерное меню на каждый день медицинской диеты «5 стол»:Как долго нужно питаться по диете №5— Длительность данной диеты определяется исключительно врачом, — подчеркнула эксперт.Срок лечебной программы питания зависит от динамики течения имеющегося заболевания. Иногда продолжительность диеты может составлять до полутора лет.

https://rsport.ria.ru/20201218/pokhudenie-1589908647.html

https://ria.ru/20201216/voda-1589509891.html

https://ria.ru/20201216/sekret-1589474115.html

https://radiosputnik.ria.ru/20201221/menyu-1589943402.html

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2020

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdnn21.img.ria.ru/images/154897/64/1548976425_107:0:1814:1280_1920x0_80_0_0_9b718a9d5a6f815abbc14d0dc06a0e58.jpg

РИА Новости

[email protected] ru

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

общество, продукты, питание, диета, витамины, здоровый образ жизни (зож)

МОСКВА, 24 дек — РИА Новости. Стол номер 5 — рацион питания, разработанный еще в 1920-х годах. Когда его назначают и что он в себя включает — в материале РИА Новости.

Показания к применению

Особая диета под названием «Стол №5» назначается специалистами людям с заболеваниями печени, желчевыводящих путей и желчного пузыря: холецистите, гепатите, желчнокаменной болезни. Также ее можно применять для общего оздоровления организма.

Питание «по столам» разработал основатель диетотерапии, советский врач Мануил Певзнер. Его диеты являются лечебными или создают благоприятные условия для восстановления организма человека. Также они помогают избежать обострения болезней.

Система русского врача активно применяется при лечении заболеваний в стационарах, санаториях. Также столы рекомендуют пациентам и вне стен лечебных учреждений.

— Эта система питания учитывает наиболее часто встречающиеся острые и хронические заболевания. Ведь именно питание и образ жизни часто являются основой выздоровления. Сейчас в современной диетологии потихоньку отходят от разделения на «столы», но, тем не менее, именно такая классификация облегчает работу с пациентами и повышает комплаентность — склонность пациентов соблюдать рекомендации врача, — рассказала РИА Новости диетолог-эндокринолог Раушания Хисматуллина.

18 декабря 2020, 15:30ЗОЖКак похудеть за две недели? Советы от фитнес-моделиВсего система включает в себя 15 групп рационов. Диеты столов №1, 1а, 1б назначают при язве желудка и двенадцатиперстной кишки; диету стола №2 — при атрофическом гастрите, колитах; диету стола №3 — при запорах; диеты столов №4, 4а, 4б, 4в — при болезнях кишечника с диареей; диеты столов №5, 5а — при заболеваниях желчных путей и печени; диету стола № 6 — при мочекаменной болезни, подагре; диеты столов №7, 7а, 7б, 7в, 7г — при хроническом и остром нефрите, хронической почечной недостаточности; диету стола №8 — при ожирении; диеты стола №9 — при сахарном диабете; диету стола №10 — при заболеваниях сердечно-сосудистой системы; диету стола №11 — при туберкулезе; диету стола №12 — при заболеваниях нервной системы; диету стола №13 — при острых инфекционных заболеваниях; диету стола №14 — при болезни почек с отхождением камней из фосфатов; диету стола №15 — при заболеваниях, не требующих особых диет.

Часто эти рационы питания называют столами ОВД. Аббревиатура расшифровывается как «основной вариант диеты».

Цель диеты «Стол номер 5»

При полноценном рационе диета стола 5 способствует снижению нагрузки на печень и желчевыводящую систему.

Щадящее питание диеты «Стол №5» способствует нормализации работы желчных путей и печени, улучшает желчеотделение и налаживает обмен холестерина в организме.

16 декабря 2020, 15:07НаукаУченые рассказали о лечебных свойствах обычной воды

Общая характеристика диеты

Рацион диетического стола 5 включает в себя нормальное содержание белков и углеводов в меню, но ограниченное количество жира. Готовить блюда разрешается двумя способами — их нужно варить и запекать, правда, изредка можно тушить. Подавать готовую еду нужно только в теплом виде.

Мясо и рыбу важно мелко рубить, делать из них фарш или суфле. Разрешены для 5 стола рецепты протертых овощных, молочных и крупяных супов. При этом они должны быть без мяса, рыбы и грибов. Масла можно использовать только в качестве заправок к блюдам, а молочные продукты следует выбирать с пониженной жирностью. Яйца допускается есть в ограниченном количестве, лучше всмятку или в составе омлета.

Хлеб при диете стола 5 нужно употреблять вчерашний. Также можно включать в питание сухари или галеты. Из круп врачи рекомендуют гречку, овес, манку, рис. Кроме того, разрешаются макароны из твердых сортов пшеницы.

Овощи можно отваривать, запекать, есть сырыми. Разрешается включить в меню 5 стола горошек, морковь, тыкву, свеклу, помидоры, огурцы, картофель, кабачки, цветную капусту. Овощи, богатые клетчаткой, важно перетирать.

Из фруктов можно есть бананы, груши и некислые яблоки, а вот зелень и специи, грибы, чеснок, редис нужно ограничить.

Из десертов разрешены желе, запеканки, пудинги, мед и сухофрукты. В ограниченном количестве можно есть пастилу, мармелад и варенье. Из напитков — травяные чаи, некрепкий черный и зеленый чай, соки, компоты, кисели.

Запрещено употреблять острое, копченое, жареное, субпродукты, консервы, сало. Полностью исключаются из рациона соусы, газировка, спиртное, какао и черный кофе. Также нельзя шоколад, мороженое, клюкву, цитрусовые.

16 декабря 2020, 12:45

Диетолог раскрыла секрет сохранения отличной формы во время праздников

Режим питания

Во время соблюдения диеты 5 стола обязательно пить много воды натощак. Питаться важно дробно — употреблять небольшие равные порции 5 -6 раз в день, через каждые 2,5-3 часа.

— Частое дробное питание небольшими порциями, в теплом виде, не перегружает желудочно-кишечный тракт и способствует мягкому желчеоттоку, — отметила Раушания Хисматуллина.

Суточный рацион (энергетическая ценность и химический состав)

Продукты и блюда, включенные в питание в сутки, должны содержать до 80 грамм белков (50% из которых животного происхождения), до 80-90 грамм жиров (30% из которых растительного происхождения), а также до 400 грамм углеводов. Кроме того, необходимо выпивать до 1,5-2 литров воды.

Общая энергетическая ценность суточного рациона при диете «Стол №5» — примерно 2400 — 2800 килокалорий. При этом разрешается употреблять не более 10 грамм соли.

Примерное меню на каждый день медицинской диеты «5 стол»:

  • Завтрак: творог низкопроцентной жирности со сметаной и сахаром, овсянка на воде или нежирном молоке, чашка некрепкого чая.
  • Второй завтрак: печеное яблоко
  • Обед: суп из овощей на растительном масле без мяса, отварная курица в молочном соусе, вареный рис, компот из свежих фруктов или сухофруктов
  • Полдник: отвар из шиповника, несдобная выпечка с творогом
  • Ужин: нежирная вареная рыба в сметанном соусе, пюре из картофеля, ватрушка с творогом, чашка некрепкого чая
  • За полчаса перед сном — стакан низкопроцентного по жирности кефира.

Как долго нужно питаться по диете №5

— Длительность данной диеты определяется исключительно врачом, — подчеркнула эксперт.

Срок лечебной программы питания зависит от динамики течения имеющегося заболевания. Иногда продолжительность диеты может составлять до полутора лет.

21 декабря 2020, 04:00Сказано в эфиреДиетолог рекомендовала «антиковидное» меню

Диета «5-й стол» на неделю

Диета «Стол № 5» — лечебный план питания, разработанный ученым-диетологом Михаилом Певзнером. Создана специально для тех, кто имеет проблемы с желчным пузырем, желчевыводящими путями и печенью, чтобы улучшить работу этих органов и оздоровить их.

В частности эта диета назначается при таких заболеваниях, как гепатит, холецистит, панкреатит, желчнокаменная болезнь, подагра.

© Depositphotos

Диета «5-й стол» на неделю

В первую очередь сокращается количество потребляемых жиров. А также удаляются из рациона продукты с высоким содержанием пуринов, щавелевой кислоты, холестерина, эфирных масел, экстрактивные вещества. Меню наполняется продуктами, богатыми клетчаткой, пектинами и липотропными веществами.

© Depositphotos

Все блюда варятся, тушатся либо запекаются с малым количеством соли. Калорийность дневного меню составляет приблизительно 2 500 калорий, из них 80 г белка, 80 г жиров и 400 г углеводов, которые распределяются на 4–6 приемов пищи.

© Depositphotos

Список продуктов и блюд, которые можно употреблять

  1. Некислые сорта фруктов и ягод
  2. Черная икра
  3. Макароны
  4. Сухарики, галеты, сухие бисквиты
  5. Варенье, мёд, мармелад, сахар не более 70 г в день
  6. Сливочное и растительное масло
  7. Овощные соки, отвар шиповника, травяной чай, кофе с молоком
  8. Из специй: петрушка, укроп, лавровый лист, гвоздика, корица, ваниль
  9. Молочные и овощные супы с крупами
  10. Не более 200 г молочных и кисломолочных продуктов в день
  11. Не больше 1 яйца в день
  12. Постное мясо
  13. Нежирная рыба
  14. Каши на воде или молоке
  15. Хлеб вчерашней выпечки
  16. Сырые, вареные, тушеные овощи, особенно морковь и свекла

© Depositphotos

Список запрещенных продуктов и блюд

  1. Алкоголь
  2. Субпродукты
  3. Бобовые
  4. Консервированные и маринованные блюда
  5. Грибы
  6. Газированные напитки
  7. Холодные напитки
  8. Уксус
  9. Любые жареные, жирные и острые блюда
  10. Жирные сорта мяса, птицы и рыбы
  11. Шоколад и какао
  12. Лук, редис, шпинат, щавель, чеснок, ревень, репа, цветная капуста, редька

© Depositphotos

Меню на день диеты «Стол № 5»

  1. Завтрак: мясные тефтели, приготовленные на пару, манная каша, чай.
  2. Второй завтрак: банан или запеченное яблоко.
  3. Обед: овощной суп, паровые котлеты либо курица с отварной гречкой или рисом. Компот или сок.
  4. Полдник: сухарики или галеты, отвар из шиповника.
  5. Ужин: отварная рыба с белым соусом и отварными овощами. Пюре картофельное, ватрушка с творогом, чай.

© Depositphotos

Еще один вариант меню

  1. Первый завтрак: сырники из нежирного творога, овсяная или манная каша на воде. Чай с ложкой мёда.
  2. Второй завтрак: сухофрукты, свежее яблоко.
  3. Обед: суп из овощей на растительном масле (подсолнечном или оливковом), отварная курица в молочном соусе, отварной рис. Компот из сухофруктов.
  4. Полдник: отвар из шиповника.
  5. Ужин: котлеты из свеклы, чай, хлеб.

На ночь можно пить кефир. Попробуй питаться по такой схеме неделю. Если через семь дней почувствуешь себя лучше, можешь продлить диету на месяц. Если будет ощущение, что чего-то в рационе не хватает, проконсультируйся с доктором.

© Depositphotos

Вкусная диета «Стол № 5» не только поправит твое здоровье, но и поможет похудеть. Избавившись от жареных и жирных продуктов, ты наладишь метаболизм и лишний вес начнет уходить сам собой.

Больше о лечебных диетах и о том, как подобрать нужную, исходя из потребностей организма, читай в наших статьях. Переходи по ссылкам.

Диета № 5П (Щадящая диета)

Рекомендуемые продукты и блюда Исключаемые продукты и блюда
Хлеб пшеничный из муки 1-го и 2-го сорта
подсушенный или вчерашний, в виде сухарей,
несладкое сухое печенье
Ржаной и свежий хлеб, изделия из сдобного и слоеного теста
Супы вегетарианские и протертые с картофелем, морковью, кабачками,тыквой, овсяной, гречневой
крупами, рисом, вермишелью. Добавляют 5 г сливочного масла или 10 г сметаны
Супы на мясном, рыбном бульоне, отваре грибов и овощей, с пшеном, молочные супы, борщ, щи, холодные (окрошка, свекольник)
Нежирных сортов говядина, телятина, кролик, курица, индейка, птица без кожи.
В отварном или паровом виде, протертое, рубленое(котлеты, кнели, пюре, суфле и др.).
Нежирные цыплята, кролик, телятина — куском, отварные.
Жирные сорта мяса животных и птиц (утки, гуся), жареное, тушеное, печень, мозги, почки, колбасы, консервы, копчености
Нежирная в отварном виде, куском и рубленая. Заливная после отваривания.
Жирные виды рыб, жареная и тушеная, копченая и соленая рыба, консервы, икру
Молочные продукты преимущественно пониженной
жирности.Свежий некислый творог 9% жирности и нежирный, кальцинированный в натуральном виде, паста, паровые и запеченные пудинги.
Молоко при переносимости. Кисломолочные напитки. Сметана и сливки — в блюда, неострый, нежирный сыр
Молочные продукты повышенной жирности и с включением сахара
Белковый омлет из 2 яиц, желтки — ограниченно (до 1/2 в день) в блюда Яйца, сваренные вкрутую и жареные, блюда из цельных яиц
Протертые и полувязкие каши из овсяной, гречневой, манной крупы, риса, сваренные на воде или пополам с молоком.
Крупяные суфле, пудинги
с творогом, запеканки, макаронные изделия
Бобовые, рассыпчатые каши, ограничивают — перловую, ячневую, кукурузную крупу, пшено
Овощи отварные и запеченные в протертом виде. Картофель, морковь, цветная капуста, свекла, кабачки, тыква, зеленые горошек Репа, редька, редис, белокочанная капуста, щавель, шпинат, лук, чеснок, перец сладкий, грибы
Закуски исключают
Спелые, мягкие, некислые фрукты и ягоды, протертые сырые, запеченные яблоки,
желе, муссы с заменителями сахара или
полусладкие на сахаре
Шоколад, варенье, мороженое, сырые не протертые фрукты и ягоды, виноград, финики, инжир, бананы, кондитерские изделия
Молочные, на некрепком овощном отваре соусы, фруктово-ягодные полусладкие подливки, муку не пассируют Соусы на мясном, рыбном, грибном бульонах, томатный соус, все пряности
Слабый чай с лимоном, полусладкий с молоком, отвар шиповника, фруктово-ягодные соки без сахара Какао, кофе, газированные и холодные напитки, виноградный сок
Сливочное масло (30 г), рафинированные растительные масла (10-15 г) в блюда Другие жиры

Диетические столы (лечебные диеты) № 1-15 по Певзнеру

Диетические столы лечебного питания были разработаны одним из ведущих основоположников диетологии и гастроэнтерологии в СССР профессором М. И. Певзнером. Диеты, распределенные по лечебным столам, представляют собой систему питания, направленную на усиление комплексного лечения различных заболеваний. Она нашла широкое распространение и внедрялась в больницах, клиниках, санаториях, оздоровительных учреждениях. Также диеты назначали пациентам при выписке из лечебных заведений, которым им следовало придерживаться в течение определенного промежутка времени, который зависел от недуга пациента.

Система состоит из 15 столов лечебного питания, которые соответствуют определенным группам болезней. Столы, кроме номера, также имеют категорию, которая обозначается буквой. Категория указывает на стадию или период течения процесса заболевания – обострение, затухающее обострение, выздоровление.

Показания к назначению стола лечебного питания

Диета №1, 1а, 1б – язва желудка и двенадцатиперстной кишки;

Диета №2 – колиты, гастриты, в том числе и атрофический;

Диета №3 – нарушение перистальтики кишечника и частые запоры;

Диета №4, 4а, 4б, 4в – болезни, связанные с разжижением стула;

Диета №5, 5а, 5п, 5щ – болезни печени и желчевыводящих путей;

Диета №6 – заболевания мочевыделительной системы, подагра;

Диета №7,7а,7б, 7в, 7г – нефрит в хронической и острой форме, ХНП;

Диета №8 – лишний вес и ожирение разной степени;

Диета №9 – сахарный диабет всех типов;

Диета №10 – болезни сердца и сосудов;

Диета №11 – туберкулез;

Диета №12 – заболевания нервной системы;

Диета №13 – инфекционные заболевания в острой форме;

Диета №14 – камни в почках;

Диета №15 – болезни, которые не требуют соблюдения специальных диет.

Система столов по Пензеру не является заменой основному лечению, но она способна значительно облегчить жизнь и ускорить процесс выздоровления.

Основные рекомендации для составления меню всех диетических столов

  • отсутствие приправ, исключение составляют только соль и черный перец в небольшом количестве;
  • недопустимость жареных блюд;
  • просчет белков, жиров, углеводов и минеральных солей, входящих в состав приготовленного блюда;
  • предпочтение сырым овощам и фруктам перед свежевыжатыми соками.

Главные требования к лечебному питанию

  • кроме поддержания жизненных сил являться лечебным средством;
  • играть не последнюю роль в показателях клинического развития болезни;
  • влиять на регуляторные механизмы и оказывать нейрогуморальную и конституциональную терапию; 
  • увеличивать эффективность терапевтических факторов, снижать вероятность рецидивов при хронических формах заболеваний;
  • при скрытом течении болезни обязательно придерживаться диеты для профилактики.

Диетические столы от #когдаеда?

Мы предлагаем диетические лечебное питание для:

  • больниц, клиник, стационаров,
  • санаторно-курортного отдыха,
  • лечебных заведений.

Наши блюда отвечают всем медицинским требованиям и приготовлены из высококачественных продуктов.

меню на неделю, рецепты блюд на каждый день

Диета 5 — это ноу-хау советcкого ученого и диетолога М. Певзнера, и она вошла в комплекс из основных 15 видов лечебных столов. Стол предназначен для лечения печени в период ремиссии и обострений. При соблюдении общих правил этой лечебной диеты можно добиться быстрейшего восстановления и выздоровления пациента.

Предназначение диеты

Диета предписывается в период выздоровления и обострения таких заболеваний:

  • Холецистит.
  • Цирроз.
  • Гепатит.
  • Желчнокаменная болезнь.

Важно! Питание, заложенное в основу стола 5, восстанавливает функции печени. Также оно подходит для очищения пени здоровых людей, ведь меню сбалансированное с пониженным количеством жиров.

Общая характеристика и рекомендации

Говоря о диете номер 5: что можно что нельзя, стоит выделить режим питания и правила приготовления пищи:

  • Объем жидкости 1,5-2 л.
  • Жилистое мясо мелко рубят или готовят из него фарш.
  • Соль потребляется умеренно (10 г в сут.), острые специи и овощи исключаются.
  • Холодная и горячая пища исключается из рациона. Блюда и питье должны быть слегка теплыми.
  • Запрещены продукты с пуриновыми соединениями и щавелевой кислотой, грубая клетчатка.

Совет! В меню этой диеты отсутствуют жаренные блюда. Кипящий жир, а потом жаренное в нем мясо или рыба, наносят огромный удар по печени. Поэтому рекомендуется использовать тушение, варку или запекание.

Химический состав лечебного рациона

В рационе присутствует 80 г белка и жиров, 400 г углеводов, калорийность стола 5 диеты составляет 2,4-2,8 тыс. ккал в сут.

Важно! В меню Певзнера 30% растительных, и 70% животных жиров. В европейских диетах для печени соотношение ровно противоположное – 70% растительных, и 30% животных жиров.

Лечебная диета 5 стол: что можно что нельзя?

Меню диеты богато сытной пищей, которую пациент употребляет 5 раз в день. Певзнер считал, что дробное питание обеспечивает лучшую усвояемость, предотвращает нагрузки на печень и возможность кислой изжоги.

Список продуктов, которые запрещены:

  • Алкоголь, газированные напитки за исключением рекомендованных врачом лечебных вод.
  • Острые овощи (редька, редис, чеснок, лук).
  • Щавель, специи и приправы, раздражающие пищевод.
  • Уксус и все виды жирных соусов.
  • Раздражающие какао и шоколад.
  • Субпродукты, консервы, жиросодержащее мясо и жиры (смалец, сало), грибы и бобовые культуры.
  • Свежий хлеб и сдобу, кофе, крепкий чай.

Важно! Диета 5 подразумевает то, что все блюда готовятся дома, хлеб подсушивается, а натощак пациент обязательно выпивает 1 ст. теплой воды за 30 мин. до завтрака.

Рекомендованные продукты

Диета стол номер 5 подразумевает в меню такие продукты:

  • Суп. Можно варить его на молоке, некрепком овощном бульоне. Чистый некрепкий мясной бульон употребляется без мяса, но с овощами.
  • Молочные продукты. Можно есть умеренное количество нежирных кисломолочных продуктов и твердых сыров, пить молоко, кефир и ряженку с жирностью до 1%.
  • Нежирное мясо курицы, кроля, индейки, малое количество говядины и свинины. Также можно рыбу (лещ, хек, треска, черная икра). После отваривания рыбу и мясо можно запечь, чтобы употреблять как отдельное блюдо.
  • Каши и макароны твердых сортов. Их готовят на воде, молоке, также употребляют в виде пудинга и молочного супа.

  • В меню диеты стол 5 на каждый день есть разрешенное 1 яйцо в сутки. Его можно добавлять в выпечку, готовить омлет или варить вкрутую.
  • Овощи, такие как морковь, свекла, кабачки. Употребление в любом виде.
  • Фрукты и ягоды, за исключением кислых плодов. Готовят из них кисель, желе, компот, едят в сыром и вареном виде.
  • В день можно съесть 70 г сладостей, таких как пастила, мармелад, домашний джем, мед, зефир.
  • Из напитков рекомендованы домашние кисели, компоты, слабый черный чай.
  • В пищу не добавляют жир, разрешено минимальное количество сливочного масла с низкой жирностью.

Совет! Не допускается употребление творога и сыра с жирностью свыше 6%.

Из этого базового набора продуктов и блюд составляется для диеты стол 5 меню на каждый день. Меню зависит от стадии и специфики состояния пациента.

Два варианта меню

Длительность соблюдения лечебного питания составляет 1 неделю, целесообразность его дальнейшего соблюдения определяет врач.

  • Завтрак: салат из желтка и твердого сыра, подсушенный хлеб, некрепкий чай.
  • Второй завтрак: запеченное сладкое яблоко, можно добавить 1 ч. л. меда.
  • Обед: гречневая каша, запеченное куриное мясо, кисель из ягод.
  • Полдник: стакан молока.
  • Ужин: мясной рулет, подсушенный хлеб, запеченные овощи.

Вариант №2 меню на неделю диеты стол 5

  • Завтрак: рисовый суп, стакан некрепкого чая, хлеб.
  • Второй завтрак: 100 г нежирного творога.
  • Обед: фрикадельки, овощной салат, чай.
  • Полдник: стакан сладких ягод.
  • Ужин: пюре из картофеля и кабачка, запеченный судак, овсяный отвар.

Важно! Последний прием пищи за 2-3 часа до сна, а после ужина можно выпить стакан воды или киселя.

Чтобы разнообразить рацион пациента можно готовить блюда по разработанным для диеты 5 рецептам блюд на каждый день.

Специальные рецепты:

Кабачки, фаршированные курицей

Для приготовления вам понадобятся:

  • Куриная грудка.
  • 2 крупных кабачка.
  • ½ стакана риса.
  • 1 морковь.

Курицу отварите и перекрутите на фарш, рис тоже приготовьте, а кабачки разрежьте пополам, вычистите середину так, чтобы получилась лодочка. Выложите в кабачки рисово – куриную смесь, по желанию добавьте морковь. Запекают блюдо от 15 мин. до готовности кабачков. В меню диеты 5 стол его дают пациенту в обед по 100 г не чаще 2 раз в неделю.

Десерт: бабка творожная на пару

Для приготовления блюда потребуется 250 г нежирного творога, 1 яйцо, 2 ст. л. манки или муки с отрубями, 1 ст. л. меда или сахара.

 

Творог смешивают с яйцом и манкой, добавляют мед, растирая смесь до однородности. Готовят блюдо на пару, предварительно разложив его в силиконовые формы. Более удобно готовить такой десерт в пароварке, выставляя режим на 30 мин.

Совет! Если вы желаете получить запеканку с нежной консистенцией, то лучше добавить 1 ст. л. манной крупы.

Диета номер 5 позволяет есть такой десерт в первой половине дня, но не более 70 г в день.

Зефир-желе из спелых абрикосов

Для этого десерта потребуется 200 г очень спелых абрикосов, рекомендуется брать сорт Калировка. Далее, фрукты моют, вытягивают косточки, растирают их в пюре, можно удалить шкурки.

 

После этого пюре смешивают с 1 ст. л. сахара и 3 ст. л. воды кипятят, через 3 мин. вводят взбитый до пиков белок и 4 г желатина, растворенного в воде. Полученную смесь выливают в креманки, охлаждают, пациенту подают блюдо комнатной температуры.

Важно! Зефир рекомендован в последние дни соблюдения диеты в период выздоровления.

Эта диета по отзывам пациентов позволяет скорректировать состояние, облегчая боль и приближая период выздоровления. Главное правильно соблюдать предписания, а меню на каждый день диеты номер 5, разрешенные продукты и режим прописывает лечащий врач.

Диета стол №5 по Певзнеру: меню и рецепты

Соблюдение диет необходимо не только для избавления от лишних килограммов. Правильное питание может помочь в лечении заболеваний или предотвратить их обострение. В данной статье вы узнаете об особенностях 5 диетического стола по Певзнеру.

Михаил Певзнер — советский диетолог, разработавший ряд диет для людей с различными заболеваниями. Его вариант меню под номером 5 показан для людей, имеющих проблемы с поджелудочной железой, желчным пузырём и печенью.

Чаще всего эту диету назначают пациентам с диагнозами острый или хронический гепатит, желчнокаменная болезнь, хронический или острый холецистит, цирроз печени.  При этих болезнях правильное питание позволяет снизить нагрузки на органы, что в свою очередь благоприятно сказывается на восстановлении их работы и предотвращении обострений.

Стол номер 5 — полноценная сбалансированная диета, в рационе которой в нужных пропорциях присутствуют жиры, белки, углеводы. Значит соблюдать данный стол можно на протяжении всей жизни, а не только в период обострения болезни или после операции.

Данная диета является лечебной, её нужно соблюдать. Ваша ответственность и дисциплинированность помогут сохранить и восстановить здоровье. Это гораздо важнее внешнего вида, который всегда можно исправить.

Примерное меню диеты и популярные рецепты.

Диета номер 5 по Певзнеру довольно щадящая. Она категорически запрещает лишь жареные блюда, жирную пищу и продукты, содержащие пурины. Отказ от этих продуктов будет способствовать не только восстановлению внутренних органов, но и снижению веса.

Меню 5 диеты должно быть разнообразным. Вы можете есть практически всё при соблюдении ряда правил:

  • Исключена жарка продуктов и использование жиров и масел. Исключение составляют оливковое и льняное масла.
  • Питайтесь не менее 5 раз в день в одно и тоже время с одинаковыми перерывами между приёмами пищи.
  • Ежедневно выпивайте большое количество воды. Не менее полутора литров. Точный объем необходимой жидкости определяется из расчёта 60 мл на каждый килограмм.
  • Откажитесь от консервированных продуктов.

5 стол подразумевает полный отказ от грибов, жирного мяса и рыбы и бульонов на них. Под запретом также шпинат, щавель, редька, лук, чеснок. Исключаются из рациона печень, ливер, колбасы, утка. Свежий хлеб, все изделия из сдобного теста, шоколад и другие сладости также входят в список запрещённых продуктов.

Во время лечебной диеты нужно сделать акцент на нежирном мясе без сухожилий, молочных супах и овощных бульонах. Можно употреблять все крупы, овощи и некислые ягоды и фрукты в любой кулинарной обработке. Разрешены и кисломолочные продукты с небольшой жирностью.

Предлагаем вам примерное меню 5 стола на один день.

Завтрак должен быть полноценным. Приготовьте гречу и заправьте её сливочным маслом. Затем съешьте 100 гр творога и запейте стаканом чая. Можно приготовить омлет из белков на пару и морковно-яблочный салатик.

На второй завтрак можно приготовить один крупный фрукт — яблоко, апельсин, грушу или банан (около 100 граммов). Можно выпить стакан кефира или свежевыжатого сока из любого разрешённого овоща или фрукта.

Обед можно сделать вегетарианским. Приготовьте вегетарианский супчик (в 300 гр овощного бульона добавьте по 50 гр капусты и картофеля, 20 гр моркови, 40 гр кабачков и 5 гр зелени). Можно приготовить стейк из нежирной говядины или рыбы и подать его вместе с салатом из свежих овощей.

Крупяной суп на овощном отваре или молочный суп с добавлением макаронных изделий — также хорошие варианты блюд на обед.
На полдник выпейте стакан компота с печеньем или сухариками. Можно перекусить фруктом или стаканом фреша.

На ужин можно приготовить рыбу на пару вместе с картофельным пюре. Можно приготовить салат из овощей или рататуй. Для приготовления последнего блюда вам понадобятся баклажаны, кабачки, морковь, картофель в равных пропорциях.

На ночь выпейте стакан кефира.

Длительное соблюдение диеты позволит вам избавиться от болезненных признаков основного заболевания, очистить организм от шлаков, сбросить лишние килограммы, улучшить состояние кожи и ногтей.
Теги по теме: питаниеродители

Оцените материал:

спасибо, ваш голос принят

 

Диета стол №5 — что можно и нельзя, таблица и меню на неделю

Категория продуктов Что можно Что нельзя
Мясные изделия, птица Постные сорта телятины, говядины, филе индейки и курицы, кролик Все жирные сорта мяса, куски с жилами и фасциями (подлежат удалению), утка, гусь, дичь, кожа птиц, все мясные консервы и копчености
Рыба Нежирная речная и морская рыба: короп, щука, окунь, лещ, судак, минтай, хек, хоки и пр. Допустимо включать в меню малые порции морепродуктов: мидии, кальмары, креветки Жирные сорта рыбы: сазан, севрюга, сардина, скумбрия, сельдь, лососевые (семгу и лосось можно вводить в рацион в обработанном виде в малых количествах, таким образом, чтобы не превысить суточную норму жиров), икра, рыбные консервы, копченая и соленая рыба
Крупы Рис, гречка, манка, овсянка Пшено, перловка
Макаронные и хлебобулочные изделия Макаронные изделия из муки I сорта твердых сортов пшеницы, суточный пшеничный хлеб, сухари из него, несдобное (галетное) печенье Ржаной (черный), любой свежий хлеб, макароны из муки II сорта, сдоба, выпечка из слоеного теста
Овощи Кабачки, картофель, тыква, морковь, свекла – после кулинарной обработки, огурцы – свежие, за исключением консервированных, немного петрушки и укропа разрешено добавлять за 10 минут до окончания готовки блюда Капуста (все виды), шпинат, щавель, салат, чеснок, лук, томаты, редис, редька, спаржа, бобовые овощи (чечевица, горох, арахис, бобы, фасоль), все соленые и маринованные плоды, грибы
Ягоды и фрукты Яблоки, бананы, персики – только после кулинарной обработки (варка, запекание, суфле), сушеные сладкие ягоды и фрукты, изготовленные без ароматизаторов и пропитки сахарным сиропом Любые свежие фрукты и ягоды, особенно, черешня, клубника, малина, кизил, клюква, а также плоды, не присутствующие в списке разрешенных
Яйца Не более 1 шт. в день в виде парового омлета на воде или цельном обезжиренном молоке Отваренные яйца, особенно вкрутую, сырые, яичница, жареный омлет
Жиры Растительное масло, предпочтительно, льняное, тыквенное, грецкого ореха, соевое, кукурузное, подсолнечное, виноградных косточек (холодного отжима), несоленое свежее сливочное масло Маргарин, любой кулинарный жир, сливочное масло строго по норме – не более чайной ложки в сутки, в качестве добавки в основное блюдо, как правило, в кашу или картофельное пюре
Напитки Минеральная воды без газа (по рекомендации врача), питьевая/родниковая вода, разведенные соки из сладких ягод и фруктов (разрешенных), компот из сухофруктов, травяные чаи, настой шиповника, кисели из фруктов и ягод (не кислых), цикорий Все алкогольные напитки, (особенно шампанское), в том числе и пиво, кофе, черный чай, газировку, лимонад, пакетированные соки, энергетики
Десерты Мед, варенье, повидло, мармелад, зефир (ограниченно) Какао, шоколад, конфеты, мороженое, печенье сладкое, халва, пирожные, рулеты, торты
Приправы к пище, соусы Сливочный соус (молочный либо сметанный) Кетчуп, томатный соус, майонез, все пряности, уксус, хрен, горчица, аджика, любые консервированные домашние заготовки
Молочная продукция Обезжиренное молоко, кефир, йогурт (без добавок и подсластителей), обогащенные пробиотиками, сметана (жирность не более 10%), ограниченно – обезжиренные сыры: тофу, сулугуни, чеддер, моцарелла, фета Молоко и кисломолочные продукты с жирностью свыше 2,5%, сливки, сметана (жирная), сыры твердых сортов, копченые и соленые сыры, плавленые и колбасные сыры и прочие продукты с пометкой «молокосодержащие»

Диета №5 или диета Певзнера: меню и особенности

Цель диеты №5

Когда человек начинает питаться по рекомендации Михаила Певзнера, у него нормализуется работа печени, желчевыводящих путей и желчевыводящих путей. Желчеотделение становится более активным. В результате пациент чувствует себя намного лучше.

Важно в диете Певзнера

Во время диеты человек употребляет нужное количество белков и углеводов, а жиров в нем немного. Клетчатка, жидкость и пектины (содержащиеся во многих фруктах) в диете № 5 занимают видное место.

Певзнер не рекомендует блюда, содержащие много азота (например, картофель), кислоты (щавель), холестерина (яйца, майонез).

При диете №5 лучше избегать жареного и острого. Это плохо для желчного пузыря и печени.

Холодные овощи (из холодильника) при диете №5 тоже лучше не употреблять.

Мясо в диете Певзнера протирают или измельчают на блендере, овощи — тоже.

Овощи Певзнер не рекомендует пассировать и тем более добавлять в жарку муку.

Во время диеты № 5 рекомендуют питаться дробно, 5-6 раз в день.

Сколько белков и жиров можно включать в дневной рацион при диете №5?

  • Белки — 100-110 грамм.
  • Жиры 60-70 грамм.
  • Углеводы — 450-500 грамм.
  • Соль — не более 8-10 грамм.

Сколько калорий в день рекомендуется для диеты № 5?

Довольно много, как для человека с хорошей физической активностью – 3000-3200 ккал в сутки.

Как рассчитать меню при диете № 5?

Завтрак с 8.00 до 9.00

Винегрет, заправленный сметаной, сливочное масло, хлеб, творог средней жирности, в течение дня вымоченная сельдь (до 20 г), чай с молоком.

Полдник с 12.00 до 13.00

Мясо отварное или запеченное в духовке, каша гречневая на воде или молоке, свежевыжатый сок.

Ужин с 16:00 до 17:00

Суп овощной без мяса со сметаной, капустой квашеной, рыбой отварной с отварным картофелем и морковью, компотом (свежим).

Второй ужин с 19:00 до 20:00

Запеканка из макарон с нежирным творогом, котлеты из капусты (запеченные), компот из фруктов и ягод.

Третий ужин в 22.00

Кисель из ягод и фруктов несладкая булочка без масла в тесте.

Худейте на здоровье, корректируйте тело и радуйтесь жизни!

Диета на неделю: диета «Стол №5»

«Если есть заболевания, требующие такой диеты, назначаю Стол №5,  – говорит Алла Пономарева. — В диете тоже ограничиваем соль, но это прописываю только в период обострения. На 2-3 недели, месяц максимум. Я думаю, что такая щадящая диета целесообразна в течение короткого времени. Длительные ограничения в питании могут серьезно навредить вашему здоровью. Это может быть застой, нехватка витаминов и минералов и другие негативные последствия. Золотое правило, которое я говорю своим пациентам, заключается в том, что вы едите только то, что можете терпеть.

Люди, страдающие некоторыми заболеваниями, могут самостоятельно подобрать себе индивидуальную диету вне обострения.И это не значит, что это будут множественные ограничения, обычно это исключения небольшого количества продуктов. И только в том случае, если больного беспокоит что-то вне обострения. Например, раньше было принято решение поместить больного с обострением язвы в стационар, но сейчас все изменилось. Если дома благоприятная атмосфера и человек дома может правильно питаться, то лучше остаться дома, ведь госпитализация – это стресс.

Если мы вернемся к диете, Стол No.5 удобна как основа, как основа и ненадолго, но если человек сидит на диете годами, то он становится психологически зависимым от еды, оторвать его от диеты психологически очень сложно. Когда пациентов что-то беспокоит, я иногда заставляю их вести дневники питания, из которых видно весь рацион. А потом методом проб и ошибок находим то, что организм не переносит, и оставляем то, что хорошо переносится.

Все мы индивидуальны, – продолжает доктор, – у нас есть свои привычки, любимые блюда, продукты.Если, пользуясь ими, человек чувствует себя хорошо, комфортно, то зачем это запрещать. Например, кто-то съел кусок свинины или баранины и чувствует себя очень хорошо, а кто-то съел диетический творог и после этого чувствует себя плохо. Отталкиваться надо от своего самочувствия, и все эти общие длительные ограничения в еде здоровья не прибавят. Наше тело само знает, что ему нужно. Поэтому, повторяю, ешьте только то, что хорошо переносите, но ничем не злоупотребляйте, нужно есть дозировано».

новый универсальный метагеномный ассемблер

Abstract

Хотя метагеномика стала предпочтительной технологией для анализа популяций бактерий, сбор метагеномных данных остается сложной задачей, что препятствует биологическим открытиям.Более того, недавние исследования показали, что сложные бактериальные популяции могут состоять из десятков родственных штаммов, что еще больше усложняет задачу метагеномной сборки. metaSPAdes решает различные проблемы метагеномной сборки, используя вычислительные идеи, которые оказались полезными при сборке одиночных клеток и высокополиморфных диплоидных геномов. Мы сравниваем metaSPAdes с другими современными сборщиками метагенома и демонстрируем, что это приводит к высококачественным сборкам в различных наборах данных.

Секвенирование метагенома стало предпочтительной технологией для анализа популяций бактерий и открытия новых организмов и генов (Tyson et al. 2004; Venter et al. 2004; Yooseph et al. 2007; Arumugam et al. 2011). В одном из ранних метагеномных исследований Venter et al. (2004) попытались собрать сложное микробное сообщество Саргассова моря, но, как говорится в исследовании, потерпели неудачу. На другой стороне спектра метагеномных исследований Tyson et al. (2004) удалось собрать простое микробное сообщество, состоящее из нескольких видов.

В этих знаковых исследованиях (Tyson et al. 2004; Venter et al. 2004) использовались обычные инструменты сборки, а именно Celera (Myers et al. 2000) и JAZZ (Aparicio et al. 2002) — с небольшими модификациями. С тех пор, как они были опубликованы, было разработано множество специализированных метагеномных ассемблеров (Koren et al. 2011; Laserson et al. 2011; Peng et al. 2011, 2012; Boisvert et al. 2012; Namiki et al. 2012; Haider et al. 2014). ; Ли и др., 2016). Тем не менее, биоинформатики все еще пытаются преодолеть разрыв между сборкой простых и сложных микробных сообществ (обзор см. в Gevers et al.2012). Между тем, многим исследователям удалось выделить многочисленные популяционные геномы из сложных метагеномов (Hess et al., 2011; Dupont et al., 2012; Iverson et al., 2012; CL Dupont, D Kaul, A Bankevich, DB Rusch, RA Richter, J Zhang). , J Stuzka, V Montel, A Young, AE Allen, в процессе подготовки), дополняя сборку de novo разделением контигов на ячейки на основе глубины охвата, состава последовательностей, информации о парных парах и других критериев (Dick et al. 2009; Ву и Йе, 2011; Ву и др., 2014). Однако этот подход часто сталкивается с трудностями, поскольку высокая фрагментация метагеномных сборок негативно влияет как на точность бинирования, так и на смежность геномов, отнесенных к конкретным бинам.Таким образом, разработка лучших ассемблеров остается важной целью метагеномики.

Недавнее применение технологий одноклеточных (Kashtan et al. 2014) и TruSeq Synthetic Long Reads (TSLR) (Sharon et al. 2015) выявило огромное микроразнообразие родственных штаммов в различных микробных сообществах. Хотя штаммы имеют общую геномную последовательность, они часто имеют значительные вариации, возникающие в результате мутаций, вставок мобильных элементов, перестроек генома или горизонтального переноса генов.Например, секвенирование отдельных клеток показало, что дикую популяцию Prochlorococcus (наиболее распространенные фотосинтезирующие бактерии на Земле) можно рассматривать как «федерацию» сотен различных субпопуляций (некоторые из которых различаются <5% позиций) (Kashtan et al. и др., 2014; Биллер и др., 2015). Более того, почти все проанализированные одиночные клетки несли по крайней мере одну генную кассету, не обнаруженную в других клетках той же субпопуляции. Используя TSLR, Шарон и соавт. (2015) показали, что наиболее многочисленные виды в их пробах донных отложений представлены десятками родственных штаммов.Более того, исследователи утверждали, что это микроразнообразие было причиной плохой реконструкции соответствующих геномов из библиотек короткого чтения. Но микроразнообразие — это лишь одна из многих проблем метагеномной сборки, которые мы обсудим ниже.

Во-первых, сильно различающиеся уровни численности различных видов в микробном образце приводят к крайне неравномерному охвату прочтений в разных геномах. Более того, охват большинства видов типичным набором метагеномных данных намного ниже, чем в типичном проекте секвенирования культивируемого образца.В результате стандартные методы сборки, направленные на выделение геномов с высоким и довольно однородным охватом, генерируют фрагментированные и подверженные ошибкам метагеномные сборки.

Во-вторых, различные виды в микробном сообществе часто имеют общие высококонсервативные области генома. Помимо усложнения сборки и фрагментации контигов, такие «межвидовые повторы» вместе с низким охватом большинства видов могут вызывать ошибки межгеномной сборки.

В-третьих, многие виды бактерий в микробном образце представлены смесями штаммов , то есть несколькими родственными штаммами с различной численностью (Biller et al. 2014; Каштан и др. 2014; Розен и др. 2015 г.; Шарон и др. 2015). Хотя в различных исследованиях за пределами области метагеномики широко рассматривалась аналогичная проблема сборки двух гапломов в высокополиморфном эукариотическом геноме (Dehal et al., 2002; Vinson et al., 2005; Donmez and Brudno, 2011; Kajitani et al., 2014; Safonova et al. ., 2015), сборка многих близкородственных бактериальных штаммов представляет собой несколько другую задачу с уникальными вычислительными задачами. В то время как в некоторых исследованиях описаны начальные шаги к идентификации сложных вариантов штамма (Koren et al.2011 г.; Пэн и др. 2011 г.; Нейкамп и др. 2013), популярные инструменты метагеномной сборки (Boisvert et al. 2012; Peng et al. 2012; Li et al. 2016) по-прежнему включают лишь рудиментарные процедуры сборки смесей штаммов с высоким уровнем микроразнообразия.

Отметим, что каждая из описанных выше проблем уже решалась в ходе разработки инструментария сборки SPAdes, хотя и в приложениях, выходящих за рамки метагеномики. SPAdes изначально разрабатывался для сборки наборов данных с неравномерным покрытием, что является одной из ключевых проблем сборки одной ячейки (Банкевич и др.2012 г.; Нурк и др. 2013). Модуль разрешения повторов exSPAnder в SPAdes (Prjibelski et al. 2014; Vasilinetc et al. 2015; Antipov et al. 2016) был разработан для точного разрешения геномных повторов путем объединения нескольких библиотек, секвенированных с помощью различных технологий. Наконец, dipSPAdes (Safonova et al. 2015) был разработан для решения проблемы сборки двухгапломной смеси в высокополиморфном диплоидном геноме.

В то время как эти недавно разработанные инструменты SPAdes решают сложные проблемы сборки, метагеномная сборка, возможно, является еще более сложной проблемой с размерами наборов данных, которые затмевают большинство других проектов секвенирования ДНК.Тем не менее, несмотря на то, что SPAdes не был разработан для метагеномных приложений, различные группы успешно применяли его в своих метагеномных исследованиях (McLean et al. 2013; Nurk et al. 2013; Coates et al. 2014; Cotten et al. 2014; Bertin et al. и др., 2015 г.; Гарсия-Лопес и др., 2015 г.; Клейгреве и др., 2015 г.; Кляйнер и др., 2015 г.; Миллер и др., 2016 г.; Цай и др., 2016 г.; Се и др., 2016). Однако, хотя SPAdes действительно хорошо работает для сборки несложных метагеномов, таких как филаменты цианобактерий (Coates et al.2014), или MDA-амплифицированных смесей небольшого числа случайно выбранных бактериальных клеток (Nurk et al. 2013), его эффективность ухудшается в случае сложных бактериальных сообществ.

Наше новое программное обеспечение metaSPAdes сочетает в себе новые алгоритмические идеи с проверенными решениями из набора инструментов SPAdes для решения различных задач метагеномной сборки. Ниже мы описываем алгоритмические подходы, используемые в metaSPAdes, и сравниваем их с современными метагеномными ассемблерами IDBA-UD (Peng et al.2012), Ray-Meta (Boisvert et al. 2012) и MEGAHIT (Li et al. 2015).

Результаты

Схема конвейера metaSPAdes

metaSPAdes сначала строит граф де Брейна всех прочтений с использованием SPAdes, преобразует его в граф сборки, используя различные процедуры упрощения графа, и реконструирует пути в графе сборки, которые соответствуют длинным геномным фрагментам внутри метагеном (Банкевич и др. , 2012; Нурк и др., 2013). metaSPAdes работает в широком диапазоне глубин покрытия и пытается поддерживать компромисс между точностью и смежностью сборок.Отвечая на вызов микроразнообразия, metaSPAdes сосредотачивается на реконструкции согласованной основы смеси штаммов, игнорируя, таким образом, некоторые специфичные для штамма особенности, соответствующие редким штаммам.

Задача сравнительного анализа

Сборщики геномов обычно тестируются на изолятах с известным эталонным геномом с использованием различных показателей (Salzberg et al. 2012; Gurevich et al. 2013). Бенчмаркинг метагеномных ассемблеров является более сложной задачей, поскольку нет доступных эталонных метагеномов для микробных сообществ даже средней сложности.

Один из подходов к решению этой проблемы основан на идентификации эталонных геномов, тесно связанных с некоторыми геномами в метагеноме (Koren et al. 2011; Treangen et al. 2013). Однако этот подход имеет ограничения, поскольку (1) близкородственные эталонные геномы доступны только для части видов в метагеноме и (2) различия между идентифицированными эталонами и их аналогами в метагеноме часто ошибочно интерпретируются как ошибки сборки (см. «Анализ набора данных HMP» в дополнительных материалах).Другой подход к сравнительному анализу метагеномных ассемблеров использует наборы синтетических данных с известными членами сообщества. Такие наборы данных могут быть получены путем секвенирования смесей бактерий с известными геномами (Turnbaugh et al. 2007; Shakya et al. 2013), смешанных данных секвенирования изолятов (Mavromatis et al. 2007) или смоделированных на основе эталонных последовательностей (Richter et al. и др., 2008 г.; Менде и др., 2012 г.). Однако, несмотря на то, что наборы синтетических данных оказались полезными в различных тестах, они, как правило, менее сложны, чем настоящие метагеномы (Koren et al.2011 г.; Пэн и др. 2012).

Мы сравнили metaSPAdes с тремя популярными метагеномными ассемблерами — IDBA-UD (Peng et al. 2012), Ray-Meta (Boisvert et al. 2012) и MEGAHIT (Li et al. 2015) — в различных наборах синтетических и реальных данных. с помощью metaQUAST (Михеенко и др., 2016). Наборы данных были предварительно обработаны, как описано в разделе «Предварительная обработка данных» в дополнительных материалах.

Наборы данных

Мы проанализировали следующие наборы данных.

Набор данных синтетического сообщества

Набор данных синтетического сообщества (SYNTH) представляет собой набор прочтений смеси геномной ДНК 64 различных видов бактерий и архей (SRA в соотв.нет. SRX200676) (Shakya et al. 2013), который использовался для сравнительного анализа ассемблера Omega (Haider et al. 2014). Он содержит 109 миллионов считываний парных концов Illumina HiSeq размером 100 п.н. со средним размером вставки 206 п.н. Поскольку известны эталонные геномы для всех 64 видов, образующих набор данных SYNTH, мы использовали их для оценки качества различных сборок SYNTH.

Набор данных Human Microbiome Project

Human Microbiome Project Набор данных (HMP) представляет собой набор данных о спинке женского языка (SRA согл.SRX024329), созданный в рамках проекта «Микробиом человека» (Консорциум проекта «Микробиом человека», 2012 г.), который использовался для сравнительного анализа Peng et al. (2011), Treangen et al. (2013) и Михеенко и соавт. (2016). Он содержит 75 миллионов прочтений Illumina HiSeq с парными концами 95 п.н. со средним размером вставки 213 п.н. Хотя геномы, составляющие образец HMP, неизвестны, мы осторожно выбрали три эталонных генома, которые похожи на геномы в образце для сравнительного анализа.

Набор данных морского метагенома

Набор данных морского метагенома (MARINE) представляет собой набор данных морского метагенома на глубине 300 м (SRA в соотв.нет. SRX19), полученный в результате исследования функциональной геномики зоны минимума кислорода в экваториальной части Тихого океана (http://genome.jgi.doe.gov/FungenequPacific/FungenequPacific.info.html). Он содержит 48 миллионов прочтений Illumina HiSeq со 150 п.н. парными концами со средним размером вставки 245 п.н.

Набор данных об отложениях водоносного горизонта

Набор данных об отложениях водоносного горизонта (SOIL; SRA в соотв. № SRX2021633) — это один из наборов данных Illumina, полученный в результате изучения проб отложений, собранных в водоносном горизонте, прилегающем к реке Колорадо (Castelle et al.2013; Хуг и др. 2013), содержащий 32 миллиона прочтений парных концов Illumina HiSeq 150 п.н. со средним размером вставки 460 п.н. (хотя отложения водоносного горизонта представляют собой другую среду, чем почва, мы позволили себе назвать этот набор данных как ПОЧВА). Шарон и др. (2015) улучшили исходный анализ с помощью секвенирования TSLR (Кулешов и др., 2014; Маккой и др., 2014). Поскольку технология TSLR приводит к значительному улучшению метагеномных сборок (Кулешов и др., 2015; Банкевич и Певзнер, 2016; CL Dupont, D Kaul, A Bankevich, DB Rusch, RA Richter, J Zhang, J Stuzka, V Montel, A Young, AE Аллен, в процессе подготовки.), этот набор данных предоставляет уникальную возможность сравнить различные метагеномные ассемблеры на основе того, насколько хорошо они реконструируют геномные области, захваченные TSLR.

Дополнительные материалы «Наборы данных CAMI» и «Анализ наборов данных CAMI» также представляют результаты сравнительного анализа двух наборов синтетических данных, смоделированных на основе эталонных геномов в рамках инициативы «Critical Assessment of Metagenome Interpretation» (CAMI) (http://www. cami-challenge.org/).

Параметры сборки

metaSPAdes из SPAdes v3.10 (см. раздел «Доступность ПО»), MEGAHIT v1.0.6.1, IDBA-UD v1.1.1 и Ray-Meta v2.3.1 запущены в 16 потоках с (в основном) параметрами по умолчанию. IDBA-UD был запущен с включенным исправлением ошибок чтения, как это рекомендовано в руководстве для метагеномных данных. Ray-Meta была запущена с размером k -mer, равным 31. В дополнительной таблице S1 представлена ​​информация о времени работы и объеме памяти различных ассемблеров. Все ассемблеры были протестированы с использованием metaQUAST из QUAST v4.5 (Гуревич и др., 2013) (с опциями «-m 1000 —scaffolds»). metaQUAST классифицирует положение в каркасе как внутригеномную неправильную сборку , если его фланкирующие области совпадают с непоследовательными областями одного и того же эталонного генома, и как межгеномную неправильную сборку , если они совпадают с разными эталонными геномами.

Сравнительный анализ

Мы провели сравнительный анализ четырех ассемблеров (metaSPAdes, MEGAHIT, UDBA-UD и Ray-Meta) на четырех наборах данных (SYNTH, HMP, MARINE и SOIL) по широкому набору показателей, описанных ниже.

Статистика длины каркасов

предоставляет статистику длины каркасов и демонстрирует, что по отношению к общей длине каркасов (> 1 кб) Ray-Meta показал худшие результаты по сравнению с другими сборщиками для всех наборов данных. metaSPAdes значительно улучшили общую длину каркаса в случае самого разнообразного набора данных SOIL (увеличение на 21% и 40% по сравнению с IDBA-UD и MEGAHIT соответственно). Хотя все инструменты генерировали сборки с одинаковой общей длиной каркаса для набора данных HMP, metaSPAdes значительно улучшили длину 1000 самых длинных каркасов (36.5 Мб) по сравнению с МЕГАИТ (26,6 Мб) и ИДБА-УД (29,4 Мб). Точно так же, в то время как metaSPAdes и IDBA-UD приводили к сборкам одинаковой общей длины в наборе данных MARINE (269,5 и 273,7 Мб соответственно), метаSPAdes значительно улучшили длину 1000 самых длинных каркасов по сравнению с IDBA-UD (31,6 Мб против 19,3 Мб). Мб). MEGAHIT привел к худшей сборке по сравнению с metaSPAdes и IDBA-UD в этом наборе данных.

Таблица 1.

Общая длина каркасов (в мегабазах) для всех наборов данных и всех ассемблеров

приведены графики кумулятивной длины каркасов, иллюстрирующие, что metaSPAdes улучшает смежность сборок по сравнению со всеми другими ассемблерами для HMP, MARINE и SOIL наборы данных.Неожиданным выводом нашего сравнительного анализа является то, что IDBA-UD (часто рассматриваемый как более медленный предшественник MEGAHIT) улучшает непрерывность сборок MEGAHIT во всех наборах данных. «Сводка статистики Nx» в дополнительном материале представляет графики Nx для всех наборов данных (подробности о статистике Nx см. в руководстве по metaQUAST).

Суммарная длина лесов участков. На оси x каркасы упорядочены от самого длинного к самому короткому. Ось y показывает общую длину x самых длинных лесов в сборке.

Статистика предсказания генов

Чтобы дополнительно оценить, насколько фрагментированы полученные сборки, мы использовали MetaProdigal v2. 6.2 (Hyatt et al. 2012) для предсказания полных генов (опция -c) в каждой сборке. Затем предсказанные гены были пропущены через CD-HIT v4.6 (Li and Godzik 2006; Fu et al. 2012) кластеризирующее программное обеспечение (с сходством 99%), чтобы скорректировать потенциальное преимущество более избыточных сборок и сохранить только самый длинный предсказанный ген в кластер. сообщает количество и общую длину предсказанных генов >800 п.н. (порог длины был установлен для фильтрации менее надежных предсказаний коротких генов).В случае наиболее сложных наборов данных MARINE и SOIL количество предсказанных длинных генов в сборках metaSPAdes значительно больше по сравнению с другими сборками (увеличение на 14% и 66% для набора данных MARINE и увеличение на 17% и 49% для набора данных metaSPAdes). набор данных SOIL по сравнению с IDBA-UD и MEGAHIT соответственно). Хотя мы не можем исключить множество ложноположительных предсказаний генов, нет оснований полагать, что их частота значительно различается у разных ассемблеров.

Таблица 2.

Количество (в тысячах) и общая длина (в Мб) предсказанных генов >800 п.н. для всех наборов данных и всех ассемблеров -пары на подмости (>1 kb) с Bowtie 2 v2.2.4 (Лэнгмид и Зальцберг, 2012). Пара чтения классифицируется как выровненная, если оба чтения выровнены по одному и тому же каркасу в пределах 1 КБ друг от друга с правильной ориентацией. Далее мы провели различие между уникально и неуникально выровненными парами считывания и сообщили доли выровненных одиночных считываний и пар считываний для всех наборов данных и ассемблеров. Лучшие сборки характеризуются более высокой долей однозначно выровненных пар чтения и меньшей долей неуникально выровненных пар чтения.

показывает, что metaSPAdes привели к значительно более высокой доле уникально выровненных пар чтения для наборов данных HMP и MARINE по сравнению со всеми другими ассемблёрами.Это также показывает, что только 15 %, 11 %, 13 % и 2 % пар чтения в наборе данных SOIL соответствуют сборкам, созданным метаSPAdes, MEGAHIT, IDBA-UD и Ray-Meta соответственно, что подтверждает большое разнообразие это сообщество. Небольшая доля уникально выровненных пар чтения для этого сложного набора данных предполагает, что подавляющее большинство геномов в этом метагеноме имеют низкую глубину охвата чтения, что препятствует их сборке. также предоставляет долю неоднозначно выровненных пар чтения (которые выровнены по нескольким областям в сборке), тем самым выявляя потенциальную избыточность (дублированные фрагменты) в сборках.Сборки metaSPAdes имеют более низкую частоту неуникальных парных выравниваний чтения, что указывает на то, что они менее избыточны. Например, в случае набора данных HMP у metaSPAdes было <9% неоднозначно выровненных пар чтения по сравнению с 14%, 19% и 38% для IDBA-UD, MEGAHIT и Ray-Meta соответственно.

Таблица 3.

Доля выровненных одиночных и парных чтений (как уникальных, так и неуникальных) для всех наборов данных и всех ассемблеров (в процентах)

Ниже более подробно обсуждаются результаты сравнительного анализа для каждого набора данных.metaQUAST сообщает статистику NGA50 (статистика NG50 с поправкой на ошибки сборки) для оценки качества сборки отдельных геномов в метагеноме. Чтобы вычислить NGA50, контиги сначала разбиваются на более мелкие сегменты в определенных контрольных точках неправильной сборки. NGA50 для данного эталонного генома представляет собой максимальное значение, такое, что разорванные сегменты (которые выравниваются с этим эталоном) по крайней мере этой длины покрывают по крайней мере половину оснований эталона.

Набор данных SYNTH

Подробная информация о ссылках, составляющих набор данных SYNTH, приведена в дополнительной таблице S2.Статистика сборки для всех ассемблеров и ссылок обобщена в дополнительной таблице S3. «Анализ набора данных SYNTH» в дополнительном материале обсуждает значительные различия в производительности различных ассемблеров даже для этого довольно простого набора данных. Статистика сборки по 20 наиболее распространенным ссылкам сведена на .

Статистика metaQUAST для 20 наиболее распространенных видов, составляющих набор данных SYNTH. Статистика NGA50 ( вверху слева ), доля реконструированного генома по сравнению с общей длиной генома ( вверху справа ), количество внутригеномных неправильных сборок ( внизу слева ) и количество межгеномных неправильных сборок ( внизу справа ) для 20 наиболее распространенных видов, входящих в набор данных SYNTH. Ссылки обозначаются их идентификаторами RefSeq (см. Дополнительную таблицу S2) и располагаются в порядке убывания глубины охвата.

Набор данных HMP

Поскольку геномы, составляющие бактериальные сообщества, обычно неизвестны, консорциум HMP определил ряд эталонных геномов (перечисленных в профилировании сообщества HMP Shotgun SRS077736), аналогичных геномам, представленным в наборе данных HMP (Treangen et al. 2013). Однако наша попытка использовать этот ресурс для надежной оценки качества столкнулась с трудностями: только три генома в этом списке ( Streptococcus salivarius SK126 , Neisseria subflava NJ9703 и Prevotella melaninogenica ATCC 25845) были по крайней мере на 70% покрыты контигами. генерируются ассемблером, включенным в это исследование.Более того, мы выявили существенные различия между этими ссылками и геномами в образце, что сделало анализ metaQUAST ненадежным (см. «Анализ набора данных HMP» в дополнительных материалах).

Набор данных MARINE

Основываясь на доле выровненных прочтений (), мы заключаем, что набор данных MARINE представляет собой более разнообразное сообщество, чем набор данных HMP, но менее разнообразен, чем набор данных SOIL. через иллюстрируют, что metaSPAdes приводит к более непрерывной и полной сборке набора данных MARINE, чем все другие ассемблеры.

Набор данных SOIL

Мы сравнили наборы данных SOIL с набором контигов, полученных Банкевичем и Певзнером (2016) из TSLR для всех трех образцов, описанных Sharon et al. (2015) (что улучшает сборки TSLR из исходного исследования). Контиги >20 т.п.н. (общая длина 103 Мб) были выбраны в качестве «эталонного генома» для расчета статистики metaQUAST (с дополнительной опцией «—fragmented»). Результаты обобщены в . Только 27,6 Мб (≈13,6%) от общей длины каркасов metaSPAdes >1 кб (196 Мб) перекрываются контигами TSLR, покрывая всего ≈26% от общей длины сборки TSLR (лучший результат среди всех ассемблеров).

Таблица 4.

Сравнение длинных каркасов (>1 т.п.н.), сгенерированных различными метагеномными сборщиками для набора данных SOIL, с контигами TSLR, сгенерированными Банкевичем и Певзнером (2016) выше, Дополнительные материалы также включают сравнительный анализ всех ассемблеров на двух наборах данных CAMI («Наборы данных CAMI» и «Анализ наборов данных CAMI»), сравнение метаSPAdes и сборок SPAdes на наборе данных SYNTH («Сравнение SPAdes с метаSPAdes») и обсуждение того, как новые алгоритмы, предложенные в этой работе, влияют на качество сборок («Влияние новых алгоритмических подходов в metaSPAdes на качество сборки»).

Обсуждение

metaSPAdes решает ряд проблем в метагеномной сборке и реализует несколько новых функций, таких как эффективная обработка графа сборки для решения проблемы микроразнообразия, новый подход к повторному разрешению, который использует редкие варианты штаммов для улучшения согласованной сборки смесей штаммов. , а также быстрые алгоритмы построения графов сборки и чтения с исправлением ошибок.

Эти функции способствовали улучшению сборок metaSPAdes (по сравнению с самыми современными сборщиками MEGAHIT, IDBA-UD и Ray-Meta) и позволили нам масштабировать metaSPAdes для анализа больших метагеномов.

В дополнение к внутренним биологическим проблемам, обсуждаемым в этой статье, область метагеномной сборки также сталкивается с технологическими проблемами, вызванными инновациями в методах секвенирования и подготовки библиотек. Например, недавно представленные высококачественные библиотеки прыжков (парных пар) (такие как Nextera Mate Pair Libraries) могут значительно улучшить качество сборки (Vasilinetc et al. 2015). Однако метагеномные ассемблеры еще не догнали эту технологическую инновацию.Другим примером является технология TSLR (Kuleshov et al. 2014; McCoy et al. 2014), первые метагеномные приложения которой выявили необходимость разработки методов надежного сочетания ее с библиотеками парных концов (Kuleshov et al. 2015; Sharon et al. , 2015; Банкевич и Певзнер, 2016). Теперь перед metaSPAdes стоит задача включения этих новых технологий в конвейер сборки.

Методы

Обнаружение и маскирование вариаций штаммов

Геномные различия между родственными штаммами часто приводят к «выпуклостям» и «вершинам» на графиках де Брейна, которые мало чем отличаются от артефактов, вызванных ошибками секвенирования при сборке генома (Pevzner et al.2004 г.; Зербино и Бирни, 2008). Например, ошибка последовательности часто приводит к выпуклости, образованной двумя короткими альтернативными путями между одними и теми же вершинами в графе де Брейна, «правильным» путем с высоким покрытием и «ошибочным» путем с низким покрытием. Точно так же замена или небольшая вставка в редком штамме (по сравнению с распространенным штаммом) часто приводит к выпуклости, образованной путем с высоким покрытием, соответствующим распространенному штамму, и альтернативным путем с низким покрытием, соответствующим редкому штамму.

Стремясь к консенсусной сборке смеси штаммов, metaSPAdes маскирует большинство штаммовых различий, используя модификацию процедур SPAdes для маскирования ошибок секвенирования (алгоритмы удаления кончиков, «простых» выпуклостей [Банкевич и др., 2012], и «сложные» выпуклости [Нурк и др., 2013]). metaSPAdes использует более агрессивные настройки, чем те, что используются в сборках изолятов; например, он разрушает большие выпуклости и удаляет более длинные кончики, чем SPAdes. Мы отмечаем, что подход с проекцией выпуклости в SPAdes улучшает первоначально предложенный подход к удалению выпуклости (Pevzner et al.2004 г.; Zerbino and Birney 2008), используемый в большинстве существующих ассемблеров, поскольку он хранит ценную информацию об обработанных выпуклостях (см. «Подход с проекцией выпуклостей» в дополнительных материалах). Эта функция важна для подхода повторного разрешения в metaSPAdes, описанного ниже.

Анализ филигранных ребер в графе сборки

Помимо однонуклеотидных вариантов и небольших вставок, штаммовая изменчивость часто проявляется в виде сильно дивергированных участков, вставок мобильных элементов, перестроек, крупных делеций, параллельного переноса генов и т. д.Зеленые ребра на графике сборки, показанные в результате дополнительной копии подвижного элемента в редком штамме 2 (по сравнению с многочисленным штаммом 1 ), в то время как синий край соответствует горизонтально перенесенный ген (или сильно дивергентная геномная область) в редком штамме 3 (по сравнению с широко распространенным штаммом 1 ). Такие ребра фрагментируют контиги, соответствующие распространенному штамму 1 ; например, зеленые ребра (внизу справа) разбивают ребро c на три более коротких ребра. Заметим, что ребра в графе сборки сгущены ; то есть они представляют собой неветвящиеся пути, образованные k -мерами.

Графики де Брейна для трех штаммов и их смеси штаммов. На рисунке показан только небольшой подграф графа де Брейна. Широко распространенный штамм (штамм 1 ) показан жирными линиями, а редкие штаммы (штамм 2 и штамм 3 908) показаны тонкими линиями.Геномный повтор R показан красным цветом. ( Вверху слева ) График де Брейна распространенного штамма 1 . ( Вверху справа ) Редкий штамм 2 отличается от распространенного штамма 1 вставкой дополнительной копии или повтора R. Два ребра точки разрыва, полученные в результате этой вставки, показаны на зеленый. Эти филигранные ребра не удаляются процедурами упрощения графа в стандартных инструментах сборки, предназначенных для изолятов. ( Внизу слева ) Редкий штамм 3 отличается от распространенного штамма 1 вставкой горизонтально перенесенного гена (или сильно дивергентной геномной области). ( Внизу справа ) График де Брейна для смеси трех штаммов.

Ребра, возникающие из редких вариантов деформаций в графе сборки смеси деформаций, называются филигранных ребер . Традиционные сборщики генома используют глобальный порог покрытия чтения, чтобы удалить ребра с низким покрытием (которые обычно возникают в результате ошибок секвенирования) из графа сборки на этапе упрощения графа.Однако этот подход плохо работает для метагеномных сборок, поскольку нет глобального порога, который (1) удаляет ребра, соответствующие редким штаммам, и (2) сохраняет ребра, соответствующие редким видам. Подобно IDBA-UD и MEGAHIT, metaSPAdes анализирует коэффициенты покрытия между соседними ребрами в графе сборки, классифицируя ребра с низким коэффициентом покрытия как потенциальные филигранные ребра.

Обозначим покрытие ребра e в ассемблерном графе как cov(e) и определим покрытие cov(v) вершины v как максимум cov(e) по все ребра e инцидентны v. Для заданного ребра e , инцидентного вершине v , и порога отношения (значение по умолчанию равно 10), вершина v доминирует над ребром e , если ее покрытие значительно выше покрытия вершины край и ; то есть, если отношение · cov(e) < cov(v). Ребро ( v,w ) является слабым , если в нем преобладает либо v , либо w . Обратите внимание, что филигранные кромки часто классифицируются как слабые, поскольку их покрытие намного ниже, чем покрытие соседних краев, возникающее в результате больших деформаций.

metaSPAdes отключает все слабые ребра от их преобладающих вершин в графе сборки. Отключение слабого ребра ( v,w ) графа сборки от его начальной вершины v (конечной вершины w ) есть просто удаление его первого (последнего) k -мера, а не удаление весь сжатый край. Подчеркнем, что, в отличие от ИДБА-УД и МЕГАИТ, мы отключаем, а не удаляем слабые ребра в графе сборки, поскольку наша цель — сохранить информацию о редких деформациях по возможности, т. е. когда это не приводит к ухудшению основу консенсуса.

Разрешение повторов с exSPAnder

exSPAnder (Prjibelski et al. 2014; Vasilinetc et al. 2015; Antipov et al. 2016) — это модуль SPAdes, который объединяет различные источники информации (например, парные чтения или длинные чтения с ошибками). ) для разрешения повторов и строительных лесов в графе сборки. Начиная с пути, состоящего из одного сжатого ребра в графе сборки, exSPAnder итеративно пытается расширить его до более длинного пути, представляющего непрерывный сегмент генома ( геномный путь ).Чтобы расширить путь, exSPAnder выбирает одно из своих ребер расширения (ребра, которые начинаются в конечной вершине этого пути). Выбор ребра расширения контролируется решающим правилом , которое оценивает, в достаточной ли мере поддерживается данными конкретное ребро расширения, в то время как другие ребра расширения — нет (с учетом существующего пути). exSPAnder дополнительно удаляет перекрытия между сгенерированными геномными путями (шаг уменьшения перекрытия ) и выводит строки, написанные полученными путями, в виде набора контигов.

metaSPAdes изменяет решающее правило exSPAnder для учета локального охвата чтения, обозначенного localCov , конкретной области генома, которая реконструируется в процессе расширения пути. Подробнее см. в разделе «Изменение правила принятия решений в exSPAnder для метагеномных данных» в дополнительных материалах. Значение localCov оценивается как минимальное по среднему покрытию ребер на расширяемом пути. Принимая во внимание минимальное (а не среднее) покрытие, мы исключаем из рассмотрения повторяющиеся ребра на пути и, как правило, недооцениваем реальное покрытие региона, делая правило принятия решения более консервативным.

Новое метагеномное правило принятия решений в metaSPAdes

Некоторые межгеномные повторы между видами с разной численностью могут быть разрешены на основе различий в глубине охвата прочтений (Haider et al. 2014; Namiki et al. 2012). metaSPAdes вводит дополнительное правило принятия решений, специфичное для метагеномики, которое отфильтровывает маловероятные расширения пути, используя оценку охвата реконструируемой области (4). Это часто позволяет metaSPAdes проходить через длинные межвидовые повторы во время реконструкции многочисленных видов.metaSPAdes применяет новое правило принятия решения, описанное ниже, только в том случае, если парные чтения не предоставили достаточных доказательств для различения ребер расширения.

Применение специфичного для метагеномики правила принятия решений для повторного разрешения. На рисунке показан только небольшой подграф графа сборки. ( A ) Путь, который в настоящее время расширяется (образован зелеными ребрами) вместе с его синими ребрами расширения e и e ′. ( B ) Ход короткого ребра от конца удлинительного ребра e .Пунктирной линией показана граница границы (е) обхода. Ребра в наборе next(e) показаны красным цветом с ребрами с низким покрытием, представленными пунктирными стрелками (другие ребра в next(e) представлены сплошными стрелками). Поскольку все ребра в next(e) имеют низкое покрытие, ребро e исключается как маловероятный кандидат на расширение. ( C ) Обход короткого ребра от конца удлинительного ребра e ′. ( D ) Поскольку e ′ является единственным ребром расширения, которое не было исключено (есть сплошное ребро в next(e′) ), оно добавляется к растущему пути, и процесс расширения продолжается.

Ребро в графе сборки называется long , если его длина превышает определенный порог (по умолчанию 1500 п.н.), и short в противном случае. Мы говорим, что длинное ребро e 2 следует за длинным ребром e 1 в геномном пути, если все ребра между концом e 1 1 902 2 в этом пути короткие.

Рассматривая ребро расширения e , metaSPAdes выполняет направленный обход графа (B), начиная с конца e и обходя короткие ребра. Мы определяем множество всех вершин, которые достигаются при этом обходе, как frontier(e) и рассматриваем множество next(e) всех длинных ребер, начинающихся в frontier(e) . Эта процедура направлена ​​на поиск неповторяющихся длинных ребер, которые могут следовать и на (неизвестном) геномном пути. Мы классифицируем ребро в наборе next(e) как ребро с низким покрытием , если оценка покрытия реконструируемой области, localCov, , превышает его покрытие, по крайней мере, на коэффициент β (значение по умолчанию β = 2).Если все ребра в next(e) являются ребрами с низким покрытием, то e считается маловероятным кандидатом на расширение текущего пути. Если все, кроме одного ребра e ‘, представляют маловероятные расширения, путь удлиняется на e ‘ (C).

Использование различий штаммов для повторного разрешения в metaSPAdes

Safonova et al. (2015) показали, что различия между гапломами можно использовать для улучшения качества консенсусной сборки высокополиморфного диплоидного генома. metaSPAdes извлекает выгоду из аналогичного наблюдения, что различия между штаммами могут быть использованы, несколько вопреки интуиции, для улучшения качества согласованной сборки смеси штаммов. В частности, контиги, созданные до маскирования различий штаммов в графе сборки и, таким образом, представляющие геномные фрагменты отдельных штаммов ( штаммов-контигов ), часто предоставляют дополнительную долгосрочную информацию для реконструкции основы смеси штаммов.

На основе dipSPAdes (Safonova et al.2015), metaSPAdes использует следующий конвейер, включающий два запуска exSPAnder().

  • Создание контигов штаммов. После построения графа сборки (который кодирует как распространенные, так и редкие штаммы) мы запускаем exSPAnder для создания набора контигов штаммов, представляющих как редкие, так и распространенные штаммы (C). Штамм-контиги не подвергаются шагу уменьшения перекрытия по умолчанию в exSPAnder.

  • Преобразование графа сборки в граф согласованной сборки. metaSPAdes идентифицирует и маскирует редкие варианты штаммов, в результате чего получается график согласованной сборки (D).

  • Генерация траекторий деформации в графе согласованной сборки. Используя подход с проекцией выпуклости (см. «Подход с проекцией выпуклости» в дополнительных материалах), metaSPAdes реконструирует пути в графе согласованной сборки, соответствующие контигам деформации, называемые путями деформации (E).

  • Повторное разрешение с использованием траекторий деформации. На этом этапе используется гибридный режим exSPAnder, изначально разработанный для включения длинных, подверженных ошибкам считываний Pacific Biosciences и Oxford Nanopore в процессе повторного разрешения (Ashton et al. 2014; Labonté et al. 2015; Antipov et al. 2016). Вместо того, чтобы работать с длинными, подверженными ошибкам чтениями, мы модифицировали exSPAnder для работы с виртуальными чтениями, записанными путями деформации, чтобы облегчить разрешение повторов в графе согласованной сборки (F).

Повторное разрешение в метагеномной сборке.( A ) Одна из двух идентичных копий длинного (длиннее размера вставки) повтора R (красный) в распространенном штамме мутировала в уникальную геномную «зеленую» область R’ в редком штамме. ( B ) График сборки, полученный в результате сочетания ридов из распространенных и редких штаммов. Два альтернативных пути между началом и концом зеленого края (один образован одним зеленым краем, а другой образован двумя черными и одним красным краем) образуют выпуклость. ( C ) Контиг штамма, охватывающий R’ (показан зеленой пунктирной линией), построенный exSPAnder на этапе «генерирования контига штамма».( D ) Маскирование вариации деформации на этапе «преобразование графа сборки в согласованный граф сборки» приводит к проекции выпуклости (образованной красными и зелеными краями) и приводит к получению согласованного графика сборки, показанного в E . Синие стрелки подчеркивают, что SPAdes проецирует , а не удаляет выпуклостей, облегчая последующую реконструкцию путей деформации в графе согласованной сборки. ( E ) Реконструкция пути деформации (зеленая пунктирная линия), соответствующего контигу штамма (зеленая пунктирная линия) на этапе «генерация путей деформации в графе согласованной сборки».( F ) На этапе «разрешение повторов с использованием путей деформации» metaSPAdes использует как пути деформации, так и парные чтения для разрешения повторов в графе консенсуса. Путь деформации из E , обведенный зелеными точками, используется в качестве дополнительной информации для реконструкции консенсусного контига cRd , охватывающего длинный повтор.

Обратите внимание, что в примере на , длинный красный повтор с множественностью 2 в распространенном штамме разрешается из-за вариантов (расходящаяся зеленая копия повтора) в редком штамме.

Масштабирование metaSPAdes

Поскольку некоторые наборы метагеномных данных содержат миллиарды прочтений, метагеномные ассемблеры должны быть оптимизированы как по скорости, так и по занимаемой памяти (Nagarajan and Pop 2013). В разделе «Сокращение времени выполнения и объема памяти метаSPAdes» в дополнительном материале описываются усилия по масштабированию метаSPAdes для сбора больших наборов метагеномных данных.

Дерепликация и секвенирование De Novo нерибосомных пептидов

Реферат

Нерибосомальные пептиды (NRP) имеют большое фармакологическое значение, но в настоящее время не существует технологии высокопроизводительной дерепликации и секвенирования NRP.Мы используем многоступенчатую масс-спектрометрию, за которой следуют алгоритмы спектрального выравнивания для секвенирования циклических NRP. Мы также представляем алгоритм сравнительной дерепликации NRP, который устанавливает сходство между недавно выделенными и ранее идентифицированными похожими, но неидентичными NRP, существенно снижая усилия по дерепликации. клетки для сборки аминокислот в белки/пептиды.Нерибосомальный синтез пептидов осуществляется нерибосомными пептидными синтетазами (NRPS), которые представляют собой как свободную от мРНК матрицу, так и строительный механизм для биосинтеза пептидов 1 . NRPS продуцируют нерибосомные пептиды (NRP), которые непосредственно не вписаны в геномы и поэтому не могут быть определены с помощью традиционного секвенирования ДНК. NRP имеют большое фармакологическое значение, поскольку в ходе эволюции они были оптимизированы для химической защиты и коммуникации. Начиная с пенициллина, NRP и другие натуральные продукты имеют беспрецедентный послужной список в фармакологии: большинство противораковых и антимикробных средств являются натуральными продуктами или их производными 2 .NRP включают антибиотики, противовирусные и противоопухолевые средства, иммуносупрессоры и токсины.

Большинство NRP содержат нестандартные аминокислоты, что увеличивает количество возможных строительных блоков с 20 (в стандартных рибосомных пептидах) до нескольких сотен. Предыдущие методы определения характеристик NRP основаны на ядерном магнитном резонансе (ЯМР) и требуют много времени и подвержены ошибкам 3 , 4 , 5 . Следовательно, существует потребность в эффективном выяснении структуры NRP.Кроме того, значительные усилия по скринингу активности могут быть сэкономлены, если новые выделенные соединения могут быть быстро связаны с известным соединением путем «дерепликации» 6 .

В новаторском исследовании 7 циклический пептид водорослей был линеаризован и секвенирован вручную с использованием тандемной масс-спектрометрии (MS 2 ). Этот подход, хотя и был успешным, не привел к надежной технике секвенирования NRP, поскольку большинство NRP избегают попыток линеаризации. Гормотамнин А представляет собой еще один пример секвенирования NRP на основе MS 8 .Барбер и др. , 9 проанализировали спектры противомикробного агента тиротрицина, смеси различных NRP, и использовали ранее идентифицированные компоненты тиротрицина для ручного получения других вариантов. Хитцерот и др. , 2005 10 повторно секвенировали новые вариации стрептоцидинов с использованием аналогичной стратегии, но отметили, что она ограничена пептидами со стандартными аминокислотами.

Мы показываем, как сравнивать спектры похожих, но неидентичных NRP, обеспечивая «сравнительную дерепликацию», которая устанавливает сходство между вновь выделенным и ранее идентифицированным подобным (а не идентичным) соединением.Поскольку многие NRP производятся как родственные аналоги (например, 61 из 90 цианопептидов, недавно идентифицированных в питьевой воде, представляют собой варианты известных пептидов 11 ), сравнительная дерепликация может сократить усилия по определению характеристик NRP с недель до минут. Например, цианопептид X представлял собой неизвестное биоактивное соединение (в настоящее время известное как десметоксимаюскуламид C), когда этот проект начинался в 2007 г., но был секвенирован с помощью ЯМР в 2008 г. Усилия, затраченные на анализ этого NRP в 2007 г., можно было бы сэкономить, если бы наш алгоритм NRP-дерепликация были доступны.Действительно, NRP-дерепликация показала, что оно связано с майюскуламидом С. Другим примером является соединение 879, которое считалось новым, но оказалось известным во время подачи заявки на патент. NRP-дерепликация показала, что это неовиридогризен. NRP-дерепликация выводит последовательность неизвестного соединения на основе базы данных известных циклических пептидов (при условии, что родственный пептид известен). В тех случаях, когда родственные NRP не известны, мы проводили секвенирование de novo с помощью алгоритмов NRP-Sequencing (алгоритм, основанный на самовыравнивании) и NRP-Tagged (подход, который использует часто встречающиеся аминокислотные метки для реконструкции пептидов).Далее мы иллюстрируем реконструкцию цианопептида X, первый отчет об автоматической реконструкции de novo циклического пептида с помощью масс-спектрометрии.

При анализе циклического пептида с помощью масс-спектрометрии стадия MS 2 сводится к расщеплению (линеаризации) циклического пептида на линейные пептиды с одинаковой исходной массой (). Смесь этих пептидов затем подвергают следующему этапу масс-спектрометрии (MS 3 ), что приводит к сложной проблеме интерпретации спектра MS 3 различных (но родственных) пептидов. Таким образом, теоретический спектр МС 3 Спектр(P) циклического пептида P = p 1 …p n является суперпозицией теоретических спектров Spectrum(P i 9n ) линейные пептиды P i = p i … p n p 1 p i 1

(рис. 8 и 1

).

Экспериментальные и теоретические спектры сеглитида Циклический (N-метил-Ala, Tyr, D-Trp, Lys, Val, Phe ( a ) Циклическая диаграмма сеглитида.А +14 обозначает метилированный аланин; целые массы остатков составляют 85, 163, 186, 128, 99 и 147. ( b ) MS 2 Фрагментация сеглитида дает до 6 линейных пептидов, представляющих различные линеаризованные варианты одного и того же циклического пептида. ( c ) Теоретический спектр сеглитида представляет собой суперпозицию масс фрагментов линеаризованного пептида. ( d ) Экспериментальный спектр сеглитида (красным цветом показаны пики, соответствующие префиксным массам).( e ) Автосвертка спектра во вставке d имеет заметные пики для смещений, соответствующих массам аминокислот (показаны красным). Пик в 0 усечен. ( f ) Генерация пептида с гэпом из теоретического спектра сеглитида. Теоретический спектр окрашен, чтобы выделить различные линейные пептиды. В иллюстративных целях показаны только 3 линеаризованных варианта циклического пептида (A +14 YWKV (синий), FA +14 YWKV (красный) и VFA +14 YWK (зеленый)).Частая 2-аминокислотная метка YW наблюдается в 3 разных местах спектра. Кроме того, смещения между 3 последовательными положениями метки YW показывают массу аминокислот F и V. ( г ) Пептид с гэпом, сконструированный из f , объединяет YW (производный от частой метки) с VF (производный от промежуточной метки). расстояния между местоположениями тегов). A +14 и K выводятся из фланговых масс YW и VF. Полная последовательность A +14 YWKVF восстанавливается, но могут быть созданы пропуски.

Сравнительную дерепликацию можно сформулировать как Задача дерепликации циклического пептида (CPDP): Учитывая экспериментальный спектр S , циклический пептид P и параметр k (максимальное количество мутаций/модификаций), найдите циклический пептид P ‘ с не более чем k мутаций/модификаций из P , который максимизирует количество общих масс между S и теоретическим спектром P ‘.

Мы обращаемся к CPDP для наиболее соответствующего случая k ≤ 1. Учитывая спектр MS 3 неизвестного пептида P ‘ и последовательность известного пептида P , которая отличается от P ‘ путем единственной мутации в неизвестной позиции x , NRP-дерепликация дает P ‘. NRP-дерепликация основана на наблюдении, что большинство пиков, общих для экспериментального спектра P ‘и теоретического спектра P , соответствуют субпептидам, которые не содержат позиции x (δ- коррелированных субпептидов).Наоборот, большинство пиков в экспериментальном спектре P ‘, которые отличаются от пиков в теоретическом спектре P на δ = Mass ( P ‘) − Mass(P) , соответствуют субпептидам, которые содержат положение x (δ- коррелируют субпептидов). Покрытие положения x определяется как количество 0 -коррелированных субпептидов, содержащих это положение, плюс количество δ- коррелированных субпептидов, не содержащих это положение.Таким образом, коррелированных субпептидов (как 0 коррелируют , так и δ- коррелируют ) могут выявить отличающуюся аминокислоту как аминокислоту с минимальным охватом. Например, падение охвата орнитином (дополнительная фигура 2) позволяет воспроизвести экспериментальный спектр тироцидина C1 с использованием последовательности тироцидина C (методы сбора данных подробно описаны в онлайн-методах).

Поскольку пептид P , который будет использоваться для дерепликации, заранее неизвестен, каждый спектр NRP необходимо сравнить с базой данных известных циклических пептидов, такой как NORINE 12 .NRP-дерепликация способна локализовать единственную мутацию, используя пептид с наивысшим баллом в NORINE (дополнительная таблица 1).

Семейство тироцидинов представляет собой идеальный тест на NRP-дерепликацию, поскольку тироцидины A, B и C входят в состав NORINE, а тироцидины A1, B1 и C1 – нет. NRP-дерепликация показывает, что спектры тироцидина A, B и C имеют лучшие совпадения, соответствующие пептидам NORINE, в то время как их аналоги A1, B1 и C1 сопоставлены с совпадениями с высокой оценкой с одной мутацией (дополнительная таблица 1). NRP-дерепликация также локализует положение с минимальным охватом как мутированное положение (которое было правильно идентифицировано для всех проанализированных нами соединений). NRP-дерепликация сгенерировала только два ложных срабатывания с высокой оценкой, представляющих очень короткие пептиды (H8495 и BQ123), но более внимательное изучение показывает, что совпадения коррелируют с пептидами запроса.

В случае, когда родственный пептид неизвестен (и, следовательно, NRP-дерепликация неприменима), мы решаем следующую задачу по секвенированию циклических пептидов (CPSP): Учитывая экспериментальный спектр S , найдите циклический пептид P максимизирует количество общих масс между S и теоретическим спектром P .

Реконструкция циклического пептида P по его теоретическому спектру Spectrum(P) представляет собой циклическую версию Partial Digest Problem (PDP) 13 . Однако непонятно, как расширить алгоритмы для PDP 13 , 14 на циклическую настройку. Кроме того, восстановление P по его экспериментальному спектру MS 3 S является сложной задачей, поскольку вклады различных линейных версий P в экспериментальный спектр неравномерны.

Певзнер и др. , 2000 15 ввела спектральную свертку и спектральное выравнивание для выявления сходства между связанными, но разными спектрами. Поскольку спектр MS 3 циклического пептида представляет собой суперпозицию спектров родственных линеаризованных пептидов, спектральная автосвертка и автовыравнивание выявляют ключевые особенности циклического пептида.

Автосвертка спектра S со смещением x определяется как количество масс s в S , такое, что s x также является массой в S ; циклическая автосвертка Conv(S,x) определяется как число масс s в S такое, что либо ( s x ), либо ( s x ) PrecursorMass(S) также является массой в S . Например, высокие балльные позиции автосвертки сеглитида выявляют массы аминокислот NRP (). Кроме того, наибольший пик Conv ( S ,85) = 14 соответствует массе метилированного аланина (A +14 ). Другие пять аминокислот в сеглитиде также соответствуют заметным пикам в положениях 99, 128, 147, 163 и 186 с Conv(S,x) ≥ 8. Спектральная автосвертка () представляет собой вычислительный подход к получению масс остатков. циклических пептидов.

Автовыравнивание спектра S со смещением x определяется как набор пиков S x = { с : s S

0 и ( 9 0 с ) ∈ S }. Мы рассматриваем автовыравнивание как виртуальный спектр с родительской массой PrecursorMass(S) x (дополнительный рисунок 5). Для сеглитида S 85 ( x=85 максимизирует Conv(S,x) для сеглитида) соответствует выравниванию между A +14 YWKVF и YWKVFA +14 .

Используя концепции автоматической свертки и автоматического выравнивания, мы представляем NRP-секвенирование, алгоритм для решения CPSP, который не требует предварительного знания масс аминокислот в соединении. NRP-Sequencing сначала использует автосвертку MS 3 для получения набора возможных масс аминокислот, а затем использует автоматическое выравнивание MS 3 с использованием верхних k возможных смещенных масс, x , для построения спектр консенсуса S x для каждого x .NRP-секвенирование дополнительно генерирует все возможные реконструкции для каждого S x и перестраивает все сгенерированные циклические пептиды в соответствии с их соответствием спектрам MS n (для n = 3, 4, 5). Более подробная информация о секвенировании NRP приведена в онлайн-методах, дополнительных рисунках 3–5, дополнительном примечании [Правильно? или приведите соответствующие цифры]. В режиме по умолчанию NRP-Sequencing выбирает массы первых 20 масс автосвертки в интервале [57, 200] Da и объединяет их с массами стандартных аминокислот.Получается, что NRP-секвенирование способно генерировать правильную последовательность (среди множества сгенерированных реконструкций) во всех случаях, когда результирующий набор масс содержит все массы аминокислот в NRP (11 соединений из 18). Более того, почти во всех случаях правильные последовательности были оценены как реконструкция с наивысшим баллом (дополнительная таблица 2). Однако успех NRP-секвенирования сдерживается возможностью определения массы всех аминокислот с помощью автосвертки. Ниже мы описываем тегирование NRP, которое устраняет это ограничение.

Поскольку некоторые положения менее склонны к разрыву, чем другие, реконструкция всех масс аминокислот в NRP с использованием автосвертки может быть недостижимой целью. NRP-мечение пытается реконструировать пептиды с гапами из MS 3 спектров циклических пептидов ().

Спектры циклических пептидов представляют собой суперпозиции родственных (циклически сдвинутых) линейных пептидов, которые, как правило, имеют одинаковые метки, повторяющиеся в спектре. Учитывая спектр MS 3 , мы находим все 2-аминокислотные метки XY (определяемые триплетами пиков s, s+X, s+X+Y в спектре) и выбираем все частые метки (т.г., теги повторяются 3 и более раз). Например, если тег XY начинается с позиций s, s+A и s+A+B , то массы A и B могут представлять две другие (соседние) аминокислоты в циклическом пептиде () . NRP-мечение сначала конструирует пептид с гэпом (например, [85,163,186,128,246] для сеглитида) и далее пытается расширить его до полноразмерных реконструкций de novo (например, [85,163,186,128,99,147]). Поскольку пептиды с гэпами часто содержат массы, представляющие объединенные массы соседних аминокислот (например,g., 246 = 99 + 147), NRP-мечение пытается разделить каждую массу в пептиде с гэпом на более мелкие массы (алгоритм подробно описан в онлайн-методах). Подобно алгоритмам для секвенирования линейных пептидов, NRP-метка обычно приближает правильный пептид к началу списка пептидов с высокими показателями (1). Эта функция облегчает дальнейший анализ NRP, например, позволяет сопоставлять реконструкции с высокими баллами с данными ЯМР. Более того, пептид с наивысшей оценкой, полученный NRP-мечением, обычно имеет незначительные отличия по сравнению с правильным пептидом, например.г., объединяя массы соседних аминокислот или выбирая массу изотопа аминокислоты.

Таблица 1

Результаты NRP-метки. Реконструированные NRP представлены в виде последовательностей масс. Для краткости массы округлены до целых. Фактические упорядоченные массы представляют собой числа с плавающей запятой. Составные массы (2 или более аминокислот) заключены в квадратные скобки. Например, [114+57] в цианопептиде × означает, что NRP-мечение вернуло 171 как массу аминокислоты вместо правильных масс 114 и 57 (Hmp и Gly).Неправильные массы заключены в фигурные скобки и выражены через их смещения от правильных масс. Например, {97+1} в h4526 означает, что NRP-тегирование вернуло 98, а правильная масса — 97 (Pro). В этом случае изотопический пик (а не b-ион) был выбран как наилучшая спектральная интерпретация. Наконец, случаи, в которых алгоритм разбивает массу, заключены в угловые скобки с правильной массой, за которой следуют массы, возвращаемые алгоритмом. Единая масса 286 в цикломарине А делится на 129, 157.Единая масса 222-18 (потеря воды) в составе 879 разделена на 100 и 104. Реконструкции, приведенные в таблице, представляют собой полную реконструкцию смеси или реконструкцию с составными массами и/или массами с известным смещением. Столбец «Лучшая реконструкция» представляет пептид с высокой оценкой с указанным рангом («Столбец ранга»), который выбран из списка всех пептидов с наивысшей оценкой как наиболее похожий на правильный пептид.

4 9 9096 4
Соединение Лучшая реконструкция

99, 114, 113, 147, 97, 147, 147, 114, 128, 163, 147, 147, 114, 128, 163 3
Tyrocidine A1 99, 128, 113, 147, 97, 147, 147, 114, 128, 163 16
Tyrocidine B 99, 114, 113, 147, 97, 186, 147, 114, 128, 163 4
Tyrocidine B1 99, 128, 113, 147, 97, 186, 147, 114, 128, 163 1
Tyrocidine C 99, 114, 113, 147, 97, 186, 186,14, 128, 186, 186,14, 128, 163 4
Tyrocidine C1 99, 128, 113, 147, 97, 186, 186, 114, 128, 163 1
Сеглитид 85, 163, 186, 128, 99, 147 1
Цианопептид X 57, 113, 161, 141 , 71, 113, [114 + 57], 127 1
BQ123 113, 186, 115, 97, 99 2
113, 113, 85, 71, [98 + 97] 2
H4526 97, 97, 163, 99, {97 + 1}, 113, {113-1}, 113 10
H8405 129, 71, 113, 113, 186 2
Микроцистин LR {[83+71]+1}, {113-1}, {129-1}, {156+1}, 313, 129 27 27
Соединение 879 113, 113, <222-18: 100,104>, {147 + 18}, 71, 141, 71 7
Cyclomamarin A 127, 139, <286 : 129,157>, 143, 71, [177 + 99] 10
дегидроцикломарин A 127, 139, 268, 143, 71, 177, 99 99, 27
Cyclomamarin C 127, 139, 270, {143+32}, {[71+177] −32}, 99 >40
Дегидроцикломарин C Не создано

При использовании масс-спектрометрии для интерпретации NRP возникает ситуация «уловки-22». С одной стороны, отсутствуют алгоритмы интерпретации спектров NRP, что не дает большого стимула для создания спектров NRP. С другой стороны, нехватка спектров NRP замедляет разработку алгоритмов интерпретации NRP, поскольку для разработки таких алгоритмов необходимы наборы спектральных данных. В этой статье представлена ​​попытка разорвать этот неудачный цикл, который, как мы надеемся, побудит исследователей натуральных продуктов начать генерировать спектры NRP.

Исследования в области вычислительной молекулярной биологии

‘) переменная голова = документ.getElementsByTagName(«голова»)[0] var script = document.createElement(«сценарий») script.type = «текст/javascript» script.src = «https://buy.springer.com/assets/js/buybox-bundle-52d08dec1e.js» script.id = «ecommerce-scripts-» ​​+ метка времени head. appendChild (скрипт) var buybox = document.querySelector(«[data-id=id_»+ метка времени +»]»).parentNode ;[].slice.call(buybox.querySelectorAll(«.вариант-покупки»)).forEach(initCollapsibles) функция initCollapsibles(подписка, индекс) { var toggle = подписка.querySelector(«.цена-варианта-покупки») подписка.classList.remove(«расширенный») var form = подписка.querySelector(«.форма-варианта-покупки») если (форма) { вар formAction = form.getAttribute(«действие») документ.querySelector(«#ecommerce-scripts-» ​​+ timestamp).addEventListener(«load», bindModal(form, formAction, timestamp, index), false) } var priceInfo = подписка.querySelector(«.Информация о цене») var PurchaseOption = toggle. parentElement если (переключить && форма && priceInfo) { toggle.setAttribute(«роль», «кнопка») переключать.setAttribute(«табиндекс», «0») toggle.addEventListener («щелчок», функция (событие) { var expand = toggle.getAttribute(«aria-expanded») === «true» || ложный toggle.setAttribute(«aria-expanded», !expanded) form.hidden = расширенный если (! расширено) { покупкаOption.classList.add(«расширенный») } еще { покупкаВариант.classList.remove («расширенный») } priceInfo.hidden = расширенный }, ложный) } } функция bindModal (форма, formAction, метка времени, индекс) { var weHasBrowserSupport = window. fetch && Array.from функция возврата () { var Buybox = EcommScripts ? EcommScripts.Buybox : ноль var Modal = EcommScripts ? EcommScripts.Модальный: ноль if (weHasBrowserSupport && Buybox && Modal) { var modalID = «ecomm-modal_» + метка времени + «_» + индекс var modal = новый модальный (modalID) modal.domEl.addEventListener («закрыть», закрыть) функция закрыть () { form.querySelector («кнопка [тип = отправить]»).фокус() } вар корзинаURL = «/корзина» var cartModalURL = «/cart?messageOnly=1» форма.setAttribute( «действие», formAction. replace(cartURL, cartModalURL) ) var formSubmit = Buybox.interceptFormSubmit( Буйбокс.fetchFormAction(окно.fetch), Buybox.triggerModalAfterAddToCartSuccess(модальный), функция () { form.removeEventListener («отправить», formSubmit, false) форма.setAttribute( «действие», formAction.replace(cartModalURL, cartURL) ) форма.представить() } ) form.addEventListener («отправить», formSubmit, ложь) document. body.appendChild(modal.domEl) } } } функция initKeyControls() { document.addEventListener («нажатие клавиши», функция (событие) { если (документ.activeElement.classList.contains(«цена-варианта-покупки») && (event.code === «Пробел» || event.code === «Enter»)) { если (document.activeElement) { событие.preventDefault() документ.activeElement.click() } } }, ложный) } функция InitialStateOpen() { var узкаяBuyboxArea = покупная коробка.смещениеШирина -1 ;[].slice.call(buybox.querySelectorAll(«.опция покупки»)).forEach(функция (опция, индекс) { var toggle = option. querySelector(«.цена-варианта-покупки») var form = option.querySelector(«.форма-варианта-покупки») var priceInfo = option.querySelector(«.Информация о цене») если (allOptionsInitiallyCollapsed || узкаяBuyboxArea && индекс > 0) { переключать.setAttribute («ария-расширенная», «ложь») form.hidden = «скрытый» priceInfo.hidden = «скрытый» } еще { переключить.щелчок() } }) } начальное состояниеОткрыть() если (window.buyboxInitialized) вернуть window.buyboxInitialized = истина initKeyControls() })()

Автоматизированный анализ наборов данных иммуносеквенирования выявляет новые гены иммуноглобулина D у различных видов

Abstract

Гены иммуноглобулинов образуются в результате рекомбинации V(D)J, которая объединяет вариабельные (V), разнообразие (D) и соединяющие (J) гены зародышевой линии. Поскольку вариации генов зародышевой линии связаны с различными заболеваниями, персонализированная иммуногеномика фокусируется на поиске аллелей генов зародышевой линии у разных пациентов. Хотя реконструкция генов V и J является хорошо изученной проблемой, более сложная задача реконструкции генов D оставалась открытой до тех пор, пока в 2019 году не был разработан алгоритм IgScout. В этой работе мы устраняем ограничения IgScout, разрабатывая вероятностный алгоритм MINING-D. для реконструкции гена D, применить его к сотням наборов данных иммуносеквенирования от нескольких видов и подтвердить недавно выведенные гены D путем анализа разнообразных наборов данных секвенирования всего генома и гаплотипирования гетерозиготных генов V.

Резюме автора

Антитела обеспечивают специфическое связывание с огромным количеством антигенов и представляют собой ключевой компонент адаптивной иммунной системы. Иммуносеквенирование стало предпочтительным методом для получения миллионов ридов, репертуаров образцов антител и дает представление о мониторинге иммунного ответа на болезнь и вакцинацию. Большинство предыдущих иммуногеномных исследований полагаются на эталонные гены зародышевой линии в локусе иммуноглобулина, а не на гены зародышевой линии у конкретного пациента .Этот подход несовершенен, поскольку набор известных генов зародышевой линии является неполным (особенно для неевропейских людей и нечеловеческих видов) и содержит аллели, возникшие в результате ошибок секвенирования и аннотации. Проблема вывода de novo генов разнообразия (D) из данных иммуносеквенирования оставалась открытой до тех пор, пока в 2019 году не был разработан алгоритм IgScout. Гены D у нескольких видов, которых нет в стандартных базах данных.

Образец цитирования: Бхардвадж В., Франческетти М., Рао Р., Певзнер П.А., Сафонова Ю. (2020) Автоматизированный анализ наборов данных иммуносеквенирования выявляет новые гены иммуноглобулина D у различных видов. PLoS Comput Biol 16(4): е1007837. https://doi.org/10.1371/journal. pcbi.1007837

Редактор: Илья Иошихес, Оттавский университет, КАНАДА

Поступила в редакцию: 20 ноября 2019 г.; Принято: 1 апреля 2020 г .; Опубликовано: 27 апреля 2020 г.

Авторское право: © 2020 Bhardwaj et al.Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: MINING-D доступен на https://github.com/vinnub/MINING-D. Все наборы данных, анализируемые в данном документе, являются общедоступными на SRA NCBI под следующими номерами присоединения — PRJEB18926, PRJNA324093, PRJNA349143, PRJNA430091, PRJNA3

, PRJNA355402, PRJNA248475, PRJNA308566, PRJNA308641, PRJEB18631, PRJEB15295, PRJNA321369, PRJNA386462, PRJNA355270, PRJNA427604, PRJEB18467, PRJNA276064, PRJNA382404, PRJNA479378 и PRJNA242290.

Финансирование: В.Б. был поддержан Qualcomm Institute в UCSD. Ю.С. был поддержан стипендиями Data Science Fellowship в UCSD и стипендией AAI Intersect Fellowship 2019. P.A.P. поддержан грантом NIh3-P41-GM103484PP. Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: P.A.P. получает компенсацию от Digital Proteomics, где он является соучредителем и акционером.

Введение

Антитела обеспечивают специфическое связывание с огромным количеством антигенов и представляют собой ключевой компонент адаптивной иммунной системы [1]. Репертуар антител генерируется соматической рекомбинацией V ( переменная ), D ( разнообразие ) и J ( соединение ) генов зародышевой линии с помощью процесса, известного как рекомбинация V(D)J. Во время этого процесса гены зародышевой линии V, D и J выбираются случайным образом, а концы генов случайным образом обрезаются и соединяются вместе с некоторыми случайными вставками между обрезанными генами, что приводит к огромному количеству уникальных рекомбинированных последовательностей. Специфичность антитела в значительной степени определяется сайтом рекомбинации, называемым третьей определяющей комплементарность областью ( CDR3 ) [2].

Иммуносеквенирование помогает в мониторинге иммунного ответа на заболевание и вакцинацию, генерируя миллионы считываний репертуаров образцов антител [3]. Информация обо всех генах иммуноглобулинов зародышевой линии, специфичных для индивидуума , является необходимым условием для анализа данных иммуносеквенирования ( Rep-Seq ).Однако большинство предыдущих иммуногеномных исследований опирались на генов зародышевой линии на уровне популяции. Поскольку набор известных генов зародышевой линии неполный (особенно для неевропейцев) и содержит аллели, возникшие в результате ошибок секвенирования и аннотации [4, 5], исследования, основанные на генах зародышевой линии на уровне популяции, могут привести к неверным результатам. Кроме того, трудно определить, какой известный аллель (аллели) присутствует у конкретного человека, поскольку широко распространенная практика сопоставления каждого считывания с ближайшим геном зародышевой линии приводит к высокой частоте ошибок [5]. Таким образом, использование генов зародышевой линии на уровне популяции, а не отдельных генов зародышевой линии, может затруднить анализ соматических гипермутаций ( SHM ) и клональное развитие репертуаров антител [6-8].

Идентификация отдельных генов зародышевой линии (то есть персонализированная иммуногеномика ) важна, поскольку вариации генов зародышевой линии связаны с различными заболеваниями [9], дифференциальной реакцией на инфекцию, вакцинацию и лекарства [10, 11], старением [12], восприимчивость к болезням [9, 13, 14].До сих пор существуют неизвестные аллельные варианты человека, а база данных International ImMunoGeneTics (IMGT) [15] неполна даже для хорошо изученных генов зародышевой линии человека [16]. Гены зародышевой линии менее изученных, хотя и иммунологически важных модельных организмов, остаются в значительной степени неизвестными [17, 18]. Сборка высокоповторяющихся локусов иммуноглобулина из данных секвенирования всего генома затруднена [19], и такие усилия, как проект 1000 Genomes, привели к лишь ограниченному прогрессу в направлении вывода общепопуляционной переписи генов иммуноглобулина зародышевой линии [19-21].

Хотя персонализированный иммуногеномный подход был впервые предложен [22], ручной анализ в этом исследовании не привел к программному инструменту для определения генов зародышевой линии. Гадала-Мария и др. [23] разработали алгоритм TIgGER для определения генов зародышевой линии и использовали его для обнаружения новых аллелей генов V. Проблема реконструкции генов V и J de novo была дополнительно решена Corcoran et al. [24], Чжан и соавт. [25], Ральф и Матсен [5] и Гадала-Мария и др.др. [26]. Однако, как прокомментировали Ralph и Matsen [5], более сложная задача реконструкции de novo генов D оставалась неуловимой.

Последовательности, кодируемые генами D, играют важную роль в развитии В-клеток, разнообразии антигенсвязывающих сайтов и продукции антител [27]. Сафонова и Певзнер [28] недавно разработали алгоритм IgScout для вывода de novo генов D с использованием данных иммуносеквенирования. В отличие от алгоритмов вывода de novo генов V и J [23, 24], он не опирается на выравнивание с ближайшими генами зародышевой линии, что может привести к ошибочным выводам [29, 30]. Вместо этого IgScout использует наблюдение, что наиболее распространенные тыс. -меров в CDR3 происходят из генов D ( тыс. относится к цепочке длиной тыс. ). Однако IgScout не имеет вероятностной модели и имеет ограничения в отношении вывода коротких генов D и генов D, которые имеют общие подстроки с другими генами D. Он опирается на знание тыс. , так что каждый тыс. -мер встречается в одном гене D (информация, которая часто недоступна), и использует эти тыс. мер в качестве семян в своей процедуре расширения семян .Тем не менее, если k -мерное семя встречается в нескольких генах D, IgScout может вообще пропустить некоторые гены D и иногда даже давать неточные результаты. Чтобы обойти эту проблему, IgScout пытается выбрать большие тыс. , чтобы гарантировать, что каждые тыс. -меров встречаются в одном гене D (например, тыс. = 15 для генов D человека). Однако использование длинных k--меров в качестве затравки приводит к отсутствию генов D, которые короче, чем эти k--меров. Таким образом, для видов с ограниченной информацией о диапазоне длин гена D IgScout неизбежно будет делать ошибки.

Наш алгоритм MINING-D использует вероятностную модель и устраняет вышеуказанные ограничения IgScout. Мы применили MINING-D почти к 600 общедоступным наборам данных Rep-seq от людей, мышей, верблюдов, макак-резусов, крыс и кроликов. Всего MINING-D выявил 13, 6, 4, 8, 12 и 15 новых генов D, используя наборы данных человека, мыши, крысы, макаки, ​​верблюда и кролика соответственно. Мы проверили 25 из этих 58 новых D-генов — 2, 1, 3, 8, 8, 3 D-гена для наборов данных человека, мыши, крысы, макаки, ​​верблюда и кролика соответственно — с использованием данных полногеномного секвенирования.Далее мы проанализировали использование генов D в различных наборах данных Rep-seq для анализа потенциальных ассоциаций между использованием гена D и окружающей средой, i . e ., состояние здоровья, ткань или тип клеток.

Методы

Вероятностная модель поколения CDR3

Трансформацию гена D (исходная строка ) в CDR3 (модифицированная строка ) можно смоделировать с помощью следующей вероятностной модели. Исходная строка s представляет собой , обрезанный в двух случайно выбранных местах p и q ( p+q |s| , где |.| обозначает длину строки), так что первые p и последние q символов s удалены (рис. 1(A)). Результирующая строка продлена слева и справа от случайно сгенерированных струн E L и R R R 8 L L и л р соответственно. Полученная строка расширяется слева на случайно выбранную строку v l из набора строк V cdr3 и справа на случайно выбранную строку j из набора строк J cdr3 для формирования модифицированной строки c .

Рис. 1.

Трансформация исходной строки, представляющей ген D, в модифицированную строку, представляющую CDR3 (а) и набор модифицированных строк, сгенерированных в соответствии с простой вероятностной моделью (б) . (a) Символы красного, желтого и зеленого цвета в модифицированной строке обозначают символы из усеченной исходной строки, случайных вставок и суффиксов V/префиксов J соответственно. Наборы суффиксов V и префиксов J показаны под измененной строкой. Обратите внимание, что показанные здесь последовательности приведены только для иллюстрации и не соответствуют никаким реальным генам.(b) В простой вероятностной модели суффиксы длины k удаляются из исходной строки, а урезанная строка расширяется на k случайных символов, где k (показаны числами слева) выбираются равномерно. наугад. Обратите внимание, что в большинстве случаев существует несколько способов создания модифицированной строки из исходной строки. Например, первая модифицированная строка может быть сгенерирована из исходной строки путем обрезки суффикса «CC» и добавления строки «TC» или путем обрезки суффикса «CCC» и добавления строки «CTC».

https://doi.org/10.1371/journal.pcbi.1007837. g001

Исходная строка s в приведенной выше модели соответствует гену D, строки e l и e 5 r соответствуют случайным вставкам, а V cdr3 и J cdr3 соответствуют наборам суффиксов CDR3 частей генов V и префиксов.Все случайные переменные в модели рисуются в соответствии с совместным распределением всех переменных.

Вывод гена D и проблема реконструкции следов

Учитывая набор C = { C 1 , C 2 2 , C 3 , …, C N } независимо сгенерированы Экземпляры модифицированных строк, сгенерированные из неизвестного набора строк семян S = { S 1 , S 2 , …, S M }, D Задача вывода генов состоит в том, чтобы реконструировать набор S исходных строк. Эту задачу можно рассматривать как версию задачи реконструкции трасс в теории информации [31] i . e ., реконструкция неизвестной строки s по совокупности ее трасс , сгенерированных в соответствии с заданной вероятностной моделью. В задаче восстановления трассы неизвестная строка s дает набор трасс, каждая трасса независимо получена из s путем удаления каждого символа с заданной вероятностью.В задачах вывода генов D следы генерируются в соответствии с более сложной вероятностной моделью с несколькими параметрами.

Простая вероятностная модель

Хотя описанный вариант задачи восстановления трассы представляет собой адекватную вероятностную модель рекомбинации VDJ, оценка совместного распределения по переменным, точно имитирующего реальные события рекомбинации, является сложной задачей. Для простоты и для развития интуитивного понимания алгоритма MINING-D мы рассмотрим более простую вероятностную модель, основанную на одной исходной строке s (представляющей один ген D), а не на наборе строк (представляющих несколько D гены), который обрезается только с одной стороны (рис. 1(В)).

Пусть s будет исходной строкой в ​​алфавите. Исходная строка генерирует измененную строку c в соответствии со следующим вероятностным процессом:

  1. Целое число обрезки k равномерно случайным образом выбирается из [0, |s| ], а суффикс s длины k обрезается.
  2. Результирующая строка расширяется на k символов справа, где каждый символ выбирается случайным образом из алфавита.

Обратите внимание, что начальная строка может генерировать одну и ту же модифицированную строку для разных значений целочисленного значения обрезки k . Например, исходная строка ATGA может генерировать модифицированную строку ATCC для k = 2 (с вероятностью 1/5*1/16 в случае 4-буквенного алфавита) или модифицированную строку ATCC для k = 3. (с вероятностью 1/5*1/64), либо модифицированная строка ATCC для k = 4 (с вероятностью 1/5*1/256). Вероятность P ( c | s ) того, что исходная строка s генерирует измененную строку c , зависит только от длины m их самого длинного общего префикса и определяется выражением (1) (2) (3) (4) где — постоянная заданная длина исходной строки и размер алфавита. Учитывая набор C = { C 1 , C 2 , C 3 , , C N } N модифицированных строк, независимо сгенерированных из одной и той же исходной строки s , вероятность того, что s сгенерирует C , вычисляется как (5)

Задача восстановления строки

Учитывая набор модифицированных строк C , сгенерированных неизвестной исходной строкой, найти строку s , максимизирующую P ( C | s )

Максимизация P ( p ( С | S ) эквивалентно максимизации, где м I 70009 I обозначает длину допустимого общего префикса S и C I .Поскольку является константой, это эквивалентно поиску строки s , которая максимизирует: (6)

Интересно, что если игнорировать вышеприведенный термин «-1», эта задача эквивалентна поиску строки s , которая максимизирует количество «красных» ячеек в матрице, показанной на рис. 1(B). Учитывая строку s , score( C | s ) можно вычислить за время O( |s|*N ).

Жадный алгоритм для вывода гена D

Хотя целевая функция в (6) может быть эффективно максимизирована (см. Дополнительное примечание: точный алгоритм решения задачи реконструкции цепочки), неясно, как обобщить этот алгоритм для более сложной модели с несколькими генами D и различной длиной модифицированных струны.Таким образом, мы описываем субоптимальный жадный алгоритм, который легче распространить на случаи, когда предположения более простой модели не выполняются. Алгоритм начинается с пустой строки и на шаге j расширяет ее справа на самый распространенный символ в C в позиции j и отбрасывает из C строки, содержащие символы, которые не являются наиболее распространенными символами. в позиции j (подробнее в дополнительном примечании: жадный алгоритм). Эта процедура повторяется до тех пор, пока длина результирующей строки не станет равной длине исходной строки s .

Чтобы учесть сложности процесса рекомбинации VDJ, нам нужно модифицировать жадный алгоритм, описанный выше. Поэтому для исходной задачи вывода гена D из последовательностей CDR3 мы описываем эвристический алгоритм MINING-D ( M метод для IN ссылка I mmu N оглобулин G ены — D ), вдохновленный с помощью приведенного выше жадного алгоритма и с учетом сложности реальных CDR3.

Алгоритм MINING-D

На рис. 2 представлена ​​схема алгоритма MINING-D.Хотя гены D обычно усекаются с обеих сторон в процессе рекомбинации VDJ, их укороченных подстрок часто присутствуют во вновь рекомбинированных генах и, следовательно, в CDR3. Таким образом, ожидается, что укороченные подстроки генов D будут очень распространены в наборе данных CDR3 (рис. 2). MINING-D сначала находит очень распространенные k -меров в наборе данных CDR3, а затем итеративно расширяет их с обеих сторон, чтобы восстановить весь ген D на основе повышенного относительного содержания расширенных подстрок. Мы иллюстрируем шаги алгоритма MINING-D на наборе данных CDR3, созданном на основе образца ERR1759678 (набор данных MOUSE). Набор данных MOUSE соответствует мыши из зоомагазина (штамм неизвестен) и состоит из 124 121 различных CDR3. В целом MINING-D не зависит от производительности входных последовательностей и может работать с любыми фрагментами области VDJ (как внутри, так и вне рамки), покрывающими весь ген D (а также короткие сегменты генов V и J).

Рис. 2. Схема алгоритма MINING-D.

(Верхний) Трубопровод ГОРНОЕ-Д. (Внизу, а) Численность 300 наиболее распространенных 10-меров в наборе данных MOUSE варьируется от 770 до 34 451. (Внизу, б) Ген AD (вверху) и его усеченные подстроки в различных CDR3 различной длины (внизу). Красная часть CDR3 представляет собой «выжившую» подстроку гена D, показанную вверху, тогда как синяя часть представляет часть гена, отличного от D (части генов V и J и случайные вставки). Некоторые подстроки исходного гена D, в основном центральные, очень распространены. (Внизу, c) k -мер расширен на основе относительной распространенности четырех показанных ( k +1) -меров слева и четырех показанных ( k +1) -меров справа .

https://doi.org/10.1371/journal.pcbi.1007837.g002

Выбор семян

MINING-D начинается с m наиболее распространенных k -меров в наборе данных CDR3, называемых seed (по умолчанию k = 10, выбор значения по умолчанию m зависит от вида и описано в дополнительном примечании: параметры MINING-D).Большинство семян представляют собой подстроки генов D или строки, которые имеют суффиксы генов V или префиксы генов J в качестве подстрок. Наша цель состоит в том, чтобы расширить семена, происходящие из генов D, в полноразмерные гены D и отфильтровать семена, происходящие из (потенциально неизвестных) генов V и J. Численность м = 300 (значение по умолчанию для наборов данных мышей) наиболее распространенных 10-меров в наборе данных MOUSE варьировалась от 770 до 34 451 (рис. 2).

Расширение начального числа

k- мер и правило остановки

Имея строку длиной l , МАЙНИНГ-Д анализирует все возможные ее расширения слева и справа на один нуклеотид.Мы проверяем гипотезу о том, что эта строка представляет собой первый (последний) 1 900 10 -мер в некоторых генах D, и, таким образом, любой нуклеотид, присутствующий непосредственно слева (справа) от этого 90 009 1 900 10 -мера в последовательностях CDR3, представляет собой случайную вставку. Если ( l +1)-мер, полученный при добавлении соответствующего нуклеотида слева (справа), также является подстрокой того же гена D, гипотеза, скорее всего, будет отвергнута, и будет произведено удлинение с использованием наиболее распространенного нуклеотида. символ расширения.

Мы начинаем вышеописанную процедуру с начальным числом k- мер.Для очень распространенного семени k -меров пусть распространенность четырех возможных расширенных ( k +1) -меров справа будет N A , N G 0 , N C и N T (рис. 2). Мы предполагаем вероятностную модель, в которой случайный нуклеотид добавляется к последним k- мерам в соответствии с некоторым распределением. Статистика S , где и E i – ожидаемая численность при распределении ( k +1)-мера с нуклеотидом i , добавленным справа от k -мера, распределена примерно по хи-квадрату. с 3 степенями свободы.Мы проверяем нулевую гипотезу о том, что случайный нуклеотид был добавлен в соответствии с равномерным распределением, и, таким образом, ожидаемые содержания равны при нулевой гипотезе. Нулевая гипотеза принимается или отвергается на основе p -значения теста. Надежность выбора равного содержания четырех ( k +1)-меров при нулевой гипотезе можно в некоторой степени контролировать, выбирая порог значимости, с которым сравнивается p -значение, чтобы принять или отвергнуть гипотезу.Низкий порог значимости приведет к отклонению гипотезы только тогда, когда наблюдаемое распределение содержаний четырех ( k +1)-меров сильно отличается от равномерного распределения, скорее всего в том случае, когда один из ( k +1)-меров гораздо больше, чем другие (см. также дополнительное примечание: параметры MINING-D). Статистический тест проводится для обоих распределений: одно с содержаниями четырех ( k +1)-меров, соответствующих расширениям слева, и другое, соответствующее расширениям справа.Если одна из двух гипотез отвергнута, k-мер расширяется до наиболее распространенного (k+1)-мера, соответствующего отвергнутой гипотезе. Если обе гипотезы отвергнуты, расширение производится в соответствии с гипотезой с меньшим p -значением теста. В любом случае, если k -mer расширяется до ( k +1)-mer, процедура повторяется до тех пор, пока обе гипотезы не будут приняты. Таким образом, для каждого очень распространенного начального числа k -меров мы генерируем строку, содержащую эти k -меров.

Поиск нескольких расширений seed

k -mers

Некоторые широко распространенные k -меры могут быть подстрочками нескольких генов D, как показано на рис. 3(A). Следуя описанной выше процедуре, если мы начнем с k -mer, который является подстрокой нескольких генов D, его удлинение, скорее всего, будет соответствовать более распространенному гену D в наборе данных CDR3 (среди генов D, содержащих эти k -меров). мер). Следовательно, иногда желательны множественные удлинения от одного распространенного k -мера.Однако, поскольку неясно, как избежать ложных срабатываний в случае множественных удлинений, алгоритм IgScout [28] использует длинные начальные k -меров (уникальные среди всех D-генов), таким образом обходя проблему множественных удлинений. Хотя этот подход работает для видов с частично известными генами зародышевой линии, неясно, как выбрать k для видов с неизвестными генами зародышевой линии и короткими генами зародышевой линии.

Рис. 3. Детали алгоритма MINING-D.

(a) 10-мерный ATTACTACGG присутствует в двух генах D мыши.(b) Средние относительные положения расширений в наборе данных MOUSE. Взаимное расположение расширений образует три кластера, каждый из которых соответствует одному из сегментов генов V, D и J. (c) График сходства для всех расширений, соответствующих генам D, до фильтрации расширений или слияния клик для набора данных MOUSE (слева) и после фильтрации расширений и слияния клик (справа). Размер узла представляет его степень.

https://doi.org/10.1371/journal.pcbi.1007837.g003

Чтобы устранить это ограничение IgScout, мы изменили описанную выше процедуру расширения. После отклонения гипотезы на любом шаге (скажем, j для j k ) и расширения j -мера до наиболее распространенного ( j +1) -мера, мы далее проверяем гипотезу о том, что остальные три ( j +1)-меров следуют случайному равномерному распределению. Если j -мер входил в состав двух D-генов и выбранный ( j +1)-мер соответствует более распространенному среди них гену D, то обилие ( j +1)-мера соответствует для менее распространенного гена D все равно будет больше, чем ( j +1)-меров, соответствующих случайным вставкам. Следовательно, гипотеза будет отвергнута, и на следующем этапе будут искаться удлинения обоих ( j +1)-меров независимым образом, что приведет к множественным удлинениям от одного распространенного k -мера. В наборе данных MOUSE 300 наиболее распространенных 10-меров приводят к 544 расширениям.

Фильтрация расширений, происходящих от генов V и J

Поскольку последовательности CDR3 содержат некоторые суффиксы генов V и префиксы генов J, многие широко распространенные k -меры в наборе данных CDR3 происходят от этих суффиксов/префиксов, а не от генов D.Следовательно, важно классифицировать удлинения как соответствующие генам V, D или J при попытке вывести гены D из последовательностей CDR3. Эта проблема становится сложной, когда гены V и J неизвестны.

Поскольку части генов V, D и J появляются в каждой последовательности CDR3 по порядку, мы используем среднее относительное положение удлинения в наборе данных CDR3, чтобы классифицировать его как соответствующее одному из генов V, D или J. Мы определяем относительное положение подстроки s в последовательности CDR3 c следующим образом: где I c ( s ) — индекс подстроки s в списке всех подстрок длины | с | в c заказывал с первого по последний.Нормализация по общему количеству подстрок длины | с | в c делается для сравнения относительных положений среди CDR3 различной длины. Относительное положение расширения во всем наборе данных CDR3 принимается как среднее значение относительных положений расширения во всех последовательностях CDR3, подстрокой которых оно является. Рассмотрение относительных положений расширений k -меров имеет некоторые преимущества по сравнению с рассмотрением относительных положений k -меров, как объяснено в дополнительном примечании: определение относительных позиций.Средние относительные положения расширений распространенных 10-меров из набора данных MOUSE показаны на рис. 3 (B). Поскольку центральный кластер, скорее всего, соответствует расширениям, соответствующим генам D, MINING-D отбрасывает расширения в левом и правом кластерах.

Однако не все уникальные расширения в центральном кластере соответствуют разным генам D. Расширения сначала фильтруются в соответствии с методом, описанным в дополнительном примечании: удаление однонаправленных расширений.Из 544 расширений, соответствующих набору данных MOUSE, после фильтрации однонаправленных расширений осталось 123, из которых только 52 были уникальными. Из этих 52 только 19 находились в центральном кластере.

Удаление ложных срабатываний

Чтобы уменьшить количество реконструкций на ген D, мы строим неориентированный граф сходства на предполагаемых расширениях. Два расширения являются соседними в графе, если они подобны . Расстояние между расширениями E 1 и E 2 определяется как dist ( E 1 , E 2 ) = мин ( | E 1 |, | е 2 | )–| Подстрока ( E 1 , E 2 ) |, где подстрока ( E 1 , E 2 ) — самая длинная общая подстрока E 1 и е 2 . Он обозначает количество нуклеотидов по краям одного расширения, которые необходимо изменить или удалить, чтобы преобразовать его в другое расширение или подстроку расширения. Чем больше это число, тем более непохожи расширения. Мы подключаем расширения E 1 и E 2 с краем, если DIST ( E 1 , E 2 ) не превышает порогового значения MaxDist (значение по умолчанию это 2).

Клики в построенном графе соответствуют группам очень похожих расширений. Для каждой клики в графе мы находим самую длинную общую подстроку среди расширений и расширяем ее, чтобы сформировать новую строку. Затем эта новая строка заменяет все расширения, образующие клику. После этой процедуры объединения кликов в наборе данных MOUSE осталось только 15 из 19 расширений. На рис. 3(C) показан график сходства между расширениями до и после фильтрации однонаправленных расширений и слияния клик для набора данных MOUSE. Чтобы создать всеобъемлющую базу данных генов D из нескольких наборов данных, соответствующих разным людям одного и того же вида и состояния здоровья, предполагаемые гены D из наборов данных были объединены и обработаны (подстроки были удалены, а сходные гены D были объединены).

Вычисление использования предполагаемых генов D

Для заданного набора D-генов мы говорим, что k -mer является уникальным , если он встречается в одном D-гене из этого набора. Мы ограничиваем внимание k -мерами длиной не менее K min нуклеотидов (значение по умолчанию K min = 8) и говорим, что CDR3-последовательность состоит из c геном D d , если c содержит уникальный k -мер из d , но не содержит уникальных t -меров из других D-генов для t k .Последовательность CDR3 является прослеживаемой , если она образована геном D, и непрослеживаемой в противном случае. Использование гена D определяется как доля прослеживаемых последовательностей CDR3, которые были сформированы геном D.

Результаты

Наборы данных иммуносеквенирования

Мы проанализировали 588 наборов данных иммуносеквенирования из 14 общедоступных проектов NCBI:

  • Человек
    1. Аллергия . 24 набора данных мононуклеарных клеток периферической крови (PBMC) и костного мозга от шести пациентов с аллергией из проекта NCBI PRJEB18926 [32].
    2. Вакцинация против гриппа .
      1. 95 наборов данных, взятых в разное время после вакцинации из проекта NCBI PRJNA324093, соответствующих разным типам клеток восьми человек [33].
      2. 18 наборов данных PBMC, взятых либо до вакцинации, либо по крайней мере через две недели после вакцинации от трех человек из проекта NCBI PRJNA349143 [34].
    3. Здоровый . 28 наборов данных PBMC, соответствующих изотипам IgG или IgM от трех человек из проекта NCBI PRJNA430091 [35].
    4. Пуповинная кровь . 6 наборов данных, соответствующих образцам пуповинной крови пяти человек из проекта NCBI PRJNA3

      .
    5. Кишечник . 35 наборов данных от семи человек, соответствующих различным типам изотипов и типов клеток из тканей слизистой оболочки подвздошной кишки и слизистой оболочки толстой кишки из проекта NCBI PRJNA355402 [36].
    6. Рассеянный склероз . 32 набора данных от четырех пациентов с рассеянным склерозом, соответствующих различным тканям с разными стадиями заболевания, из проекта NCBI PRJNA248475 [37].
    7. Гепатит В .
      1. 142 набора данных, соответствующих изотипу IgG и различным типам клеток от девяти человек после первичной вакцинации против гепатита В в рамках проекта NCBI PRJNA308566.
      2. 107 наборов данных, соответствующих изотипам IgG и IgM и различным типам клеток от девяти человек после ревакцинации против гепатита В в рамках проекта NCBI PRJNA308641.
  • Мышь . 71 набор данных из различных типов клеток (пре-В-клетки, наивные В-клетки, плазматические клетки) 20 нелеченых и иммунизированных антигеном мышей из штамма C57BL/6J и наивных клеток четырех мышей Balb/c и трех домашних мышей из NCBI. проект PRJEB18631 [38].
  • Макак . 7 наборов данных от трех индийских и четырех китайских макак-резусов из проекта NCBI PRJEB15295 [24].
  • Верблюд . 6 наборов данных, соответствующих изотипам VH и VHH от трех верблюдов из проекта NCBI PRJNA321369 [39].
  • Крыса . 10 наборов данных, каждый из которых соответствует иммунизированной крысе штамма Wistar из проекта NCBI PRJNA386462 [40].
  • Кролик . 7 наборов данных, соответствующих селезенке и РВМС трех новозеландских кроликов на разных стадиях многоступенчатой ​​иммунизации из проекта NCBI PRJNA355270 [41].

Некоторые наборы данных иммуносеквенирования в проекте представляют разные образцы данных иммуносеквенирования из одной и той же среды, представляющие одного и того же человека, ткань, изотип и т. д. (например, Донор 1, образец костного мозга 1 и Донор 1, образец костного мозга 2). Мы объединили последовательности в таких наборах данных для создания большего набора данных CDR3, соответствующего той же среде. Дополнительное примечание: в наборах данных иммуносеквенирования представлены сводки всех наборов данных иммуносеквенирования, проанализированных в этом исследовании.Метакатегории этих наборов данных были созданы для различных типов анализа и показаны в таблице 1.

Создание наборов данных CDR3

Для каждого набора данных иммуносеквенирования мы вычислили CDR3 с помощью инструмента DiversityAnalyzer [42]. Поскольку DiversityAnalyzer использует набор известных генов V и J для вычисления CDR3, а гены V и J для верблюда и макаки неизвестны, мы использовали гены V и J человека для построения CDR3 для этих видов. Поскольку на некоторые CDR3 могут повлиять ошибки подготовки образца, мы сгруппировали CDR3, отличающиеся не более чем 3 несовпадениями, и построили консенсус CDR3 для каждой группы, как описано в [28]. Конструирование консенсусных CDR3 также помогает сконцентрироваться только на рекомбинантном разнообразии (а не на SHM) наборов данных иммуносеквенирования путем удаления CDR3 с SHM в некоторой степени. Мы проигнорировали наборы данных с менее чем 15 000 консенсусных CDR3 для вывода генов D.

Известные гены D

База данных ImMunoGeneTics (IMGT) [15] содержит информацию о генах D зародышевой линии человека, мыши, крысы и кролика. Мы использовали гены IMGT D макак-крабоедов для анализа макак-резусов и гены IMGT D альпак для анализа верблюдов.В табл. 2 представлена ​​информация о генах D всех этих видов.

предполагаемые гены D

Для вывода о генах D человека были рассмотрены наборы данных РВМС из наборов данных Healthy, наборы данных PBMC о вакцинации против гриппа, взятые либо до вакцинации, либо по крайней мере через две недели после вакцинации, и наборы данных PBMC из наборов данных об аллергии (наборы данных РВМС здорового человека, таблица 1). Это было сделано для того, чтобы не включать какие-либо специфические для заболевания изменения в репертуар для вывода генов D. Для всех остальных видов использовались все доступные наборы данных.Все предполагаемые гены из набора данных иммуносеквенирования (или нескольких наборов данных) были классифицированы по следующим категориям на основе базы данных IMGT:

  • Предполагаемый ген в IMGT – предполагаемый ген либо (i) совпадает с известным геном D или известной вариацией, либо (ii) является подстрокой известного гена D или известной вариации, либо (iii) подстрока известного гена D или известной вариации, расширенная не более чем на расширений дополнительных нуклеотидов в начале и/или конце этой подстроки (по умолчанию расширений = 3).
  • Новая вариация – предполагаемый ген отличается от известного гена D в базе данных с процентной идентичностью > 75%.
  • Новый ген – предполагаемый ген имеет процент идентичности <75% по сравнению со всеми известными генами D в базе данных.

В таблице 3 представлена ​​информация о количестве предполагаемых генов D у каждого вида и их классификации по одной из вышеуказанных категорий. Чтобы сравнить производительность с IgScout, мы сравнили результаты MINING-D и IgScout для всех наборов данных Allergy из проекта PRJEB18926 и многих наборов данных, не относящихся к человеку (см. Дополнительное примечание: Сравнение MINING-D с IgScout).Для наборов данных человека IgScout не удалось реконструировать семь генов D из базы данных IMGT из всех наборов данных, тогда как MINING-D пропустил только три гена.

Новые вариации

Среди 38 ( м = 600) предполагаемых генов D из наборов данных Healthy Human PBMC, соответствующих 20 индивидуумам, 8 были помечены как новые вариации, включая четыре вариации гена IGHD3-10*01, две вариации гена IGHD3 -22*01 и единичные варианты генов IGHD2-2*01 и IGHD3-16*02.В таблице 4 представлены последовательности проверенных (процедура проверки описана ниже) новых вариаций генов человека и других наборов данных. Обратите внимание, что хотя только последовательность TTATGATTAC A TTTGGGGGAGTTATCGTTAT была выведена как новая вариация гена IGHD3-16*02 (N_Var (IGHD3-16*02)-0) по данным иммуносеквенирования, полная последовательность GTATTATGATTAC A TTTGGGGGAGTTATCGTTATACC была обнаружены в геномных чтениях (подробнее в следующем подразделе). Информация обо всех предполагаемых вариациях (включая вариации, которые не могут быть проверены с использованием геномных данных) представлена ​​в дополнительном примечании: новые вариации.

Таблица 4. Новые вариации генов D, проверенные с использованием геномных данных из наборов данных человека, верблюда, макаки-резуса, мыши, крысы и кролика.

«Исходный» относится к последовательности в базе данных IMGT. В трех предполагаемых последовательностях есть дополнительный нуклеотид на конце, который не был обнаружен в геномных прочтениях, например, новая вариация, выведенная из наборов данных мышей TTTATTACTACG A T G GTAGCTACg присутствует только как TTTATTACTACG A T G GTAGCTAC в геномных чтениях. Другие полиморфизмы, которые были обнаружены с помощью геномной проверки предполагаемых генов, подчеркнуты. Например, GATACAG C GGGTACAGT был определен MINING-D как вариант гена макака IGHD5S3*01, но вся последовательность G G GGATACAG C GGGTACAGTTAC была обнаружена в геномных чтениях.

https://doi.org/10.1371/journal.pcbi.1007837.t004

Для макак-резусов два предполагаемых новых гена представляют собой две вариации одного и того же нового гена со следующими последовательностями:

N_Gene-0                    TACAAT T TTTGGA G TGGTTAT

N_Gene-1               ATTACAAT A TTTGGA C TGGTTATTAT

Последовательности этих генов, обнаруженные в геномных данных разных особей одного и того же вида, следующие:

N_Gene-0                      GTATTACAAT T TTTGGA G TGGTTATTA C ACC

N_Gene-1               GTATTACAAT A TTTGGA C TGGTTATTA T АКК.

Валидация новых вариаций гена D с использованием данных полногеномного секвенирования

Чтобы проверить новые гены и вариации, обнаруженные MINING-D, мы загрузили геномные чтения для всех проанализированных видов и провели поиск вхождений новых генов и вариаций в этих чтениях (подробности см. в дополнительном примечании: Поиск генов D в данных полногеномного секвенирования). ). Поскольку парные наборы данных геномного и иммуносеквенирования были недоступны, считывания геномного и иммуносеквенирования были получены от разных людей (таблица 5).Мы считаем предполагаемый новый ген D или вариант подтвержденным, если он присутствует по крайней мере в 2 прочтениях и окружен RSS-мотивами с обеих сторон. В таблице 5 представлены сведения о загруженных данных и сведения о проверенных вариантах.

Таблица 5. Геномные данные, использованные для подтверждения обнаруженных вариаций гена D.

В последнем столбце указано количество наборов данных, в которых новые последовательности были обнаружены в геномных ридах, и диапазон количества ридов, в которых эти последовательности были обнаружены.Для макак-резусов мы выбрали для анализа только 4 набора данных из 1318 в проекте NCBI PRJNA382404.

https://doi.org/10.1371/journal.pcbi.1007837.t005

Использование генов D

Мы проанализировали использование всех генов IMGT D и подтвердили новые гены/вариации в наборах данных Healthy PBMC. В среднем 54,1% CDR3 можно было проследить. Использование всех генов в основном одинаково для разных людей, хотя у некоторых людей есть несколько отклонений из-за их вариаций зародышевой линии (рис. 4).Потенциальные делеционные полиморфизмы с участием нескольких смежных генов IGHD, о которых сообщалось в прошлом [13, 43], также можно увидеть на рис. 4. Донор 10, вероятно, имеет делецию генов D3-3–D6-6, а донор 11, вероятно, имеет делецию. охватывающие гены D3-22, D5-24 и D1-26.

Рис. 4. Использование различных известных и новых генов в различных наборах данных Healthy.

Каждая строка соответствует отдельному набору данных, описанному тремя крайними левыми столбцами. Первый столбец обозначает ткань, т.е. РВМС, второй столбец обозначает изотип (IgM или все/несортированные), а числа в третьем столбце представляют разных индивидуумов.Цвет в каждой ячейке представляет долю прослеживаемых CDR3, которые были сформированы геном на оси x в наборе данных, соответствующем оси y. Подтвержденные новые варианты выделены по оси x.

https://doi.org/10.1371/journal.pcbi.1007837.g004

Чтобы проанализировать относительное использование варианта гена D (известного или нового) по сравнению с другими вариантами того же гена, мы также включили костный мозг наборы данных и построили график использования вариантов в наборах данных Healthy PBMC BM (таблица 1) (рис. 5).Мы обнаружили, что обширные SHM в репертуарах IgG могут привести к неправильной классификации аллелей для некоторых генов, например. ИГГД3-16 и ИГГД2-8. Для этих генов мы точно вычисляем использование аллеля гена D, используя аллели-приманки, как объяснено в следующем подразделе.

Рис. 5. Использование вариантов генов D в наборах данных Healthy PBMC BM.

Серые линии разделяют график таким образом, что каждый подграфик соответствует одному гену и его вариантам. Каждая ячейка на подграфике представляет долю использования варианта по отношению к общему использованию всех вариантов.Таким образом, на каждом подграфике сумма всех строк равна 1. Столбцы на метках деления оси Y представляют индивидуума, ткань и изотип соответственно.

https://doi.org/10.1371/journal.pcbi.1007837.g005

В наборах стимулированных данных были замечены некоторые различия в использовании генов D в наборах данных IgG и IgM (см. Дополнительное примечание: Использование гена D). Например, в наборах данных по гепатиту В 65,4% и 45,9% CDR3 прослеживались в среднем в наборах данных, соответствующих изотипам IgM и IgG соответственно.Использование некоторых генов отличается в наборах данных, соответствующих изотипам IgG и IgM от одного и того же человека (рис. 6). Например, гены IGHD1-26*01, IGHD6-13*01 и IGHD3-3*01 чаще используются в наборах данных IgM для большинства людей, тогда как IGHD3-9*01 чаще используется в наборах данных IgG.

Точный расчет использования аллеля гена D

Высокая частота SHM в наборах данных IgG может привести к неточной маркировке CDR3 с точки зрения используемого аллеля гена D. На рис. 5 показан шахматный рисунок (особенно при использовании генов IGHD2-8 и IGHD3-16 в наборах данных IgM и IgG) для индивидуумов 0 и 1, в то время как наборы данных IgM показывают гомозиготное состояние IGHD3-16, образованного аллелем 2, наборы данных IgG показывают гетерозиготное состояние IGHD3-16, образованное известным аллелем 1 и новым аллелем N_Var-0.Это связано с тем, что предполагаемое использование гена D зависит не только от последовательности этого гена, но и от последовательностей других генов. Если два гена имеют очень похожие последовательности и только один из них присутствует в базе данных, последовательности CDR3, происходящие из обоих генов, будут присвоены той, которая присутствует в базе данных.

Когда имеется много SHM, некоторые гипермутированные чтения (CDR3) могут быть отнесены к одной из аллельных вариаций, если в базе данных присутствует только несколько (2–3, обычно зародышевой линии).Поскольку использование аллелей гена D рассчитывается с точки зрения доли общего использования гена D, даже небольшое количество гипермутированных CDR3, которые были отнесены к неправильному аллелю (поскольку не все возможные вариации гена были в база данных) может составлять значительную долю общего использования, особенно если общее использование невелико. Именно это произошло в случае генов IGHD3-16 и IGHD2-8 (рис. 5).

Чтобы обойти эту проблему, мы добавили искусственные аллели IGHD2-8, IGHD3-16 и IGHD3-10 в базу данных генов D, чтобы проверить, все ли CDR3, которые были присвоены аллелям в наборах данных IgG для субъектов 0, 1 и 2 (рис. 5) все равно будут отнесены к тем же аллелям при наличии этих ложных вариаций.Мы добавили 61 аллель для IGHD3-16, которые возможны при мутациях в выделенных участках на рис. 7.

Результаты мечения гена D показаны на рис. 8. Большинство прочтений CDR3, которые были ошибочно отнесены, были распределены среди ложных аллелей, тогда как те, которые были правильно отнесены, не распределились.

Рис. 8.

Использование аллельных вариантов для генов IGHD3-10 (a), IGHD3-16 (b) и IGHD2-8 (c). FA означает ложные аллели. Аллели, перечисленные в IMGT, показаны синим цветом.Новые предполагаемые гены показаны красным.

https://doi.org/10.1371/journal.pcbi.1007837.g008

Для генов IGHD3-16 и IGHD2-8 общее использование было намного меньше, чем для других генов, например. ИГГД3-10. Поэтому CDR3, неправильно отнесенные к аллелям, составляли значительную долю от общего числа CDR3, отнесенных ко всем аллелям гена. На рис. 8(A) показано, что результаты для генов с более высоким уровнем использования аналогичны результатам на рис. 5.

Гаплотипирование гетерозиготных генов V с использованием генов D

Чтобы подтвердить выводы о новых аллелях, обнаруженных в наборах данных Healthy, мы использовали их для вывода гаплотипов генов V.Вывод гаплотипа, когда субъекты гетерозиготны по некоторым генам, может помочь в идентификации новых аллелей генов зародышевой линии [44]. Мы проанализировали два набора данных Rep-seq, соответствующие индивидууму 2 из наборов данных Healthy PBMC (рис. 4) и индивидууму 5 из наборов данных о кишечнике (см. Дополнительное примечание: использование гена D, рис. J). Для каждого индивидуума мы выбрали гены V, которые присутствуют в соответствующих наборах данных Rep-seq в виде не менее двух аллельных вариантов. Чтобы свести к минимуму влияние артефактов подготовки образцов и SHM, мы игнорировали аллели с низким уровнем использования (<1000 различных CDR3).В результате было отобрано 12 и 9 гетерозиготных V-генов для особей 2 и 5 соответственно (табл. 6). После этого мы выделили отдельные CDR3, соответствующие каждому из выбранных аллелей, и идентифицировали в них гены D. Совместное использование аллелей генов V и D позволяет идентифицировать гаплотипы генов V и 4 гетерозиготных генов D (включая новые аллели IGHD3-10 и IGHD3-16) у особей 2 (рис. 9) и 5 ​​(рис. 10).

Рис. 9. Гаплотипы генов IGHV для индивидуума 2 из наборов данных Healthy PBMC (рис. 4).

(Верхний) Совместное использование аллелей генов V и D. Аллели генов V показаны в третьем столбце слева. Ячейка, соответствующая аллелю X гена V и аллелю Y гена D, показывает количество различных CDR3, полученных из аллелей X, Y, нормализованное по общему количеству различных CDR3, полученных из аллеля X и гена D. Серые линии разделяют график таким образом, что каждый участок соответствует одному гену и его аллелям. (Внизу) Гаплотипы IGHV выводятся в соответствии с парами аллелей генов V (синий) и D (зеленый), поддерживаемых максимальным количеством CDR3.

https://doi.org/10.1371/journal.pcbi.1007837.g009

Таблица 6. Многочисленные гетерозиготные гены IGHV у индивидуума 2 из наборов данных Healthy PBMC (рис. 4) и индивидуума 5 из наборов данных о кишечнике (рис. J).

Для индивидуума 2 использовались только наборы данных IgM. Для отдельных 5 использовались только наивные наборы данных.

https://doi.org/10.1371/journal.pcbi.1007837.t006

Мы не смогли вывести гаплотипы по гену IGHD2-2, поскольку различия между его аллелями сосредоточены в начале гена, который часто усекается.Мы также не использовали ген IGHD3-3, гомозиготный у обоих индивидуумов. У индивидуума 2 мы не смогли определить гаплотипы для 4 из 12 выбранных генов V: IGHV1-3, IGHV2-5, IGh4-23 и IGHV3-30. У индивидуума 5 мы не смогли сделать вывод о гаплотипах IGHV1-69. Мы предполагаем, что это может быть связано с наличием этих генов в нескольких копиях и СГМ (у особи 2).

Внутри индивидуума гаплотипы остальных генов V одинаковы для всех гетерозиготных генов D. Таким образом, результаты гаплотипирования дают дополнительную поддержку новым аллелям генов D и доказывают, что гетерозиготные гены D могут быть использованы для гаплотипирования локуса IGH.

Чрезмерное использование генов D в наборах данных, специфичных для состояния здоровья, ткани и/или типа клеток

Чтобы увидеть любую потенциальную связь между использованием гена D и окружающей средой (состоянием здоровья, тканью или типом клеток), мы проанализировали использование генов D в наборах данных Stimulated и Tissue-specific. Мы используем профили использования генов в наборах данных Healthy PBMC в качестве эталона и сравниваем профили использования генов D в других наборах данных.

Мы говорим, что ген чрезмерно используется в наборе данных, если использование гена в этом наборе данных как минимум в два раза превышает максимальное использование этого гена во всех наборах данных Healthy PBMC.Отношение использования чрезмерно используемого гена к максимальному использованию в наборах данных Healthy PBMC обозначается как чрезмерное использование . Использование всех генов IMGT D и проверенных новых вариаций в наборах данных здоровых людей PBMC показано на рис. 11. Подробная информация о генах, чрезмерно используемых в наборах данных вакцинации против гриппа, показана в таблице 7, а чрезмерно используемые гены в других наборах данных по стимулированным и тканеспецифическим данным представлены. показано в дополнительном примечании: чрезмерное использование генов D. В общей сложности 9 генов были чрезмерно использованы по крайней мере в 2 наборах данных одного типа во всех наборах стимулированных данных (рис. 12), а 6 генов были чрезмерно использованы по крайней мере в 2 наборах данных из наборов данных для кишечника (рис. 13).Эти результаты предполагают потенциальную связь между использованием гена D и состоянием здоровья, тканью или типом клеток, хотя трудно вывести статистически значимые ассоциации с таким небольшим размером выборки.

Рис. 11. Использование гена D во всех наборах данных Healthy.

Каждая точка над геном представляет набор данных Healthy Human PBMC. Чтобы различать использование разных генов, соседние гены представлены разными цветами.

https://doi.org/10.1371/journal.pcbi.1007837.g011

Рис. 12. Сводка чрезмерно используемых генов в наборах стимулированных данных.

Наборы данных, в которых чрезмерно используется каждый ген, выделяются и аннотируются соответствующими лицами. Перед субъектами стояла буква, соответствующая проекту: «F» для вакцинации против гриппа, «M» для вакцинации против рассеянного склероза и «H» для вакцинации против гепатита B. Некоторые гены были чрезмерно использованы в нескольких наборах данных от одного и/или разных людей. Число в скобках показывает количество наборов данных от одного и того же человека, у которого ген был чрезмерно использован.

https://doi.org/10.1371/journal.pcbi.1007837.g012

Рис. 13. Сводка чрезмерно используемых генов в наборах данных о кишечнике.

Наборы данных, в которых чрезмерно используется каждый ген, выделяются и аннотируются соответствующими лицами. Субъекты в проекте «Кишечный репертуар» имели префикс «G».

https://doi.org/10.1371/journal.pcbi.1007837.g013

Таблица 7. Чрезмерно используемые гены в наборах данных вакцинации против гриппа.

Поскольку количество наборов данных в PRJNA324093 намного больше, чем в других проектах, показаны только те гены, которые чрезмерно используются как минимум в трех разных наборах данных.Также показано чрезмерное использование гена в наборе данных. Например, использование IGHD1-1*01 в В-клетках, активированных HA+, для донора 1 в 3,7 раза превышает максимальное использование во всех наборах данных Healthy Human.

https://doi.org/10.1371/journal.pcbi.1007837.t007

Использование генов D в наборах данных о мышах

В каждом наборе данных прослеживалось в среднем 57,4% CDR3. На рис. 14 показано использование генов D мыши (аннотированных у мышей IMGT и одного подтвержденного нового варианта) в наборах данных, соответствующих наивным В-клеткам различных мышей (см. Также дополнительное примечание: использование гена D).Использование генов среди особей одного и того же штамма аналогично. Напротив, использование генов среди особей разных линий (Balb/c, C57BL/6J, домашних мышей) сильно различается. Использование генов у двух из трех мышей из зоомагазина (Pet 1 и Pet 2) неизвестных штаммов показывает отклонение от штаммов Balb/c и C57BL/6J.

Рис. 14. Использование различных известных и новых генов/вариаций в наборах данных MICE.

Столбцы слева представляют тип клеток, ткань, штамм и индивидуума соответственно.OVA, HP-HEL и HBsAg в крайнем правом столбце представляют мышей C57BL/6J, иммунизированных OVA, HP-HEL и HBsAg соответственно. Например, OVA 3 представляет мышь C57BL/6J номер 3, которую иммунизировали OVA.

https://doi.org/10.1371/journal.pcbi.1007837.g014

Гены с дифференциальным использованием в штаммах Balb/c и C57BL/6J показаны на рис. 15. Хотя ген IGHD1-1*01 указан только в как ген Balb/c в базе данных IMGT, мы предполагаем его у обоих штаммов.Мы определили гены IGHD1-2*01, IGHD2-10*01/IGHD2-11*01, IGHD2-14*01 и IGHD3-2*01 только из наборов данных Balb/c — среди них три перечислены как Гены Balb/c в IMGT, тогда как IGHD2-14*01 указан только как ген 129/Sv. Гены IGHD3-2*02 и IGHD2-5*01/IGHD2-6*01 были выведены только из наборов данных C57BL/6J. IGHD3-2*02 указан как ген C57BL/6J в базе данных IMGT. Гены IGHD2-5*01 и IGHD2-6*01 имеют одинаковую последовательность и перечислены в базе данных IMGT под штаммом CB.20 и штаммом C57BL/6J, соответственно.Результаты показывают, что помимо новой вариации, которая не указана в базе данных IMGT ни для одного штамма, существуют некоторые гены, которые перечислены в базе данных IMGT для некоторых штаммов, но также были выведены из других штаммов.

Использование генов D в наборах данных по верблюдам, макакам и крысам

31,7%, 52,6% и 54,3% CDR3 прослеживались в среднем в наборах данных Camel, Macaque и Rat соответственно (см. Дополнительное примечание: Использование гена D). Для верблюдов профили использования гена D немного отличались для изотипов VH и VHH у отдельных особей (рис. O в S1 Notes).Для крыс гены, принадлежащие к семействам IGHD2 и IGHD3, использовались гораздо реже, чем в других семействах генов (рисунок P в S1 Notes). Гены D с наибольшим использованием среди наборов данных вида показаны в дополнительном примечании: часто используемые гены D в наборах данных, не относящихся к человеку.

Обсуждение

Хотя вывод персонализированных генов иммуноглобулинов V, D и J в настоящее время признан важным шагом в анализе данных иммуносеквенирования [26], вывод генов D представляет дополнительные трудности по сравнению с выводом генов V и J гены [5].Действительно, поскольку гены D подвергаются удалению экзонуклеазой во время рекомбинации VDJ (и поскольку они намного короче, чем гены V и J), основанные на выравнивании методы, используемые для реконструкции генов V и J, не работают для реконструкции гена D.

Поскольку самые распространенные k-меры CDR3 обычно происходят из генов D, итеративное рекрутирование и расширение многочисленных k-меров в CDR3s (осуществленное в IgScout [28]) приводит к de novo -реконструкции многих зародышевых линий D гены.Производительность IgScout зависит от значения k : выбор больших k приводит к отсутствию коротких D-генов, но выбор небольших k представляет опасность рекрутирования k -меров, которые принадлежат нескольким генам D и таким образом отсутствуют некоторые из этих генов или получены неточные результаты. Для вывода генов D человека IgScout использует k = 15, поскольку все 15-меры в известных генах D человека уникальны, а все гены D человека, кроме одного, имеют длину не менее 15 нуклеотидов.Однако неясно, как подбирать параметр k для видов с еще неизвестным набором D-генов.

Описанный алгоритм MINING-D не предполагает предварительного знания длин генов D и, в отличие от IgScout, рассматривает множественные расширения тыс. -меров и, таким образом, может использовать короткие тыс. -меров в качестве начальных (значение по умолчанию тыс. -меров). = 10 не превышает длину всех известных генов D). Сравнительный анализ MINING-D на смоделированных наборах данных демонстрирует высокую точность предполагаемых генов D (Дополнительное примечание: Сравнительный анализ MINING-D на смоделированных CDR3).

Мы применили MINING-D к 588 наборам данных Rep-seq для различных видов и определили 38, 24, 16, 25, 13 и 18 генов D, используя наборы данных человека, мыши, крысы, макаки, ​​верблюда и кролика соответственно. Были известны 25 (13), 18 (6), 12 (4), 17 (8), 1 (12) и 3 (15) генов D человека, мыши, крысы, макаки, ​​верблюда и кролика (новинка) , соответственно. Мы дополнительно проверили новые гены и вариации, используя геномные данные. К сожалению, поскольку парные наборы данных Rep-seq и WGS в настоящее время недоступны, мы не смогли проверить предполагаемые гены D с помощью геномных данных, взятых у одних и тех же людей.Вместо этого мы загрузили 117 общедоступных наборов данных WGS от разных людей и провели поиск предполагаемых новых генов D и их вариаций. Всего мы подтвердили 25 из 58 новых генов/вариаций D. Существует множество причин, по которым некоторые из предполагаемых генов D не были подтверждены, например, трудно подтвердить редкий аллель гена D (поскольку парные данные WGS и Rep-Seq недоступны), предполагаемый ген может быть результатом очень распространенный SHM, а не настоящий ген D и т. д.Мы также подтвердили новые аллели генов D человека, используя гаплотипирование гетерозиготных генов V, и показали, что гаплотипы, рассчитанные с использованием новых и известных генов D, совпадают. Кроме того, мы сравнили MINING-D с наборами данных TCR (Дополнительное примечание: Сравнительный анализ MINING-D с наборами данных TCR).

Наконец, мы проанализировали использование предполагаемых генов D в различных наборах данных Rep-seq и обнаружили, что они очень консервативны у здоровых людей. Чтобы увидеть, используется ли ген в некоторых конкретных наборах данных, соответствующих состоянию здоровья, ткани и/или типу клеток, мы сравнили использование в этих наборах данных с использованием в наборах данных Healthy Human PBMC в качестве эталона.Основываясь на результатах этого сравнения, мы предполагаем потенциальные ассоциации между некоторыми генами D и состоянием здоровья, тканью и/или типом клеток, хотя небольшой размер выборки не позволяет нам сделать вывод о статистически значимых ассоциациях. Всего мы обнаружили 9 чрезмерно используемых генов среди наборов данных вакцинации против гриппа, рассеянного склероза или вакцинации против гепатита В.

Мы также проанализировали использование гена D у двух линий мышей (Balb/c и C57BL/6J) и продемонстрировали, что использование генов среди особей одной и той же (разных) линий было очень сходным (разным).Например, ген IGHD1-1*01 (который был обнаружен в обоих штаммах) гораздо чаще использовался в штамме C57BL/6J. Поскольку этот ген указан только как ген Balb/c в базе данных IMGT, мы предлагаем добавить его и в базу данных генов C57BL/6J. Точно так же мы предлагаем добавить IGHD2-14*01 к генам Balb/c, который указан только как ген 129/Sv в базе данных IMGT.

Мы продемонстрировали, что высокая скорость SHM может привести к ошибочным выводам, которые представляют собой обильные гипермутации, а не новые аллели генов D (см. Дополнительное примечание: Сравнительный анализ MINING-D на смоделированных CDR3).Таким образом, вывод о новых аллелях генов D (а также других генов иммуноглобулинов) должен быть сделан на основе данных, минимально затронутых SHM (таких как наивные данные или данные IgM/IgD Rep-Seq) с последующей проверкой предполагаемых аллелей с помощью геномные данные. Используя MINING-D, мы определили и подтвердили 25 новых генов/вариаций у людей, мышей, верблюдов, макак-резусов, крыс и кроликов. Мы утверждаем, что проверенные новые варианты генов D должны быть добавлены в стандартные базы данных генов зародышевой линии, чтобы сделать анализ данных репертуара антител более точным.Кроме того, мы также проанализировали использование известных и подтвержденных новых генов D в процессе рекомбинации VDJ и обнаружили, что, хотя использование генов аналогично в PBMC от здоровых людей, мы видим некоторые отклонения в наборах данных, которые специфичны для антигена. Хотя связь между использованием гена D и антигеном не может быть установлена ​​из-за небольшого количества образцов с определенным типом данных, наше исследование предлагает направления для будущих исследований.

Каталожные номера

  1. 1.Купер МД. Ранняя история В-клеток. Нат Рев Иммунол. 2015;15(3):191–7. Эпб 2015/02/06. пмид: 25656707.
  2. 2. Тонегава С. Соматическое поколение разнообразия антител. Природа. 1983;302(5909):575–81. пмид:6300689.
  3. 3. Турчанинова М.А., Давыдов А., Британова О.В., Шугай М., Бикос В., Егоров Е.С. и др. Высококачественное профилирование иммуноглобулинов полной длины с уникальным молекулярным штрих-кодированием. Нат Проток. 2016;11(9):1599–616. Эпб 2016/08/04. пмид: 274.
  4. 4. Ван И, Джексон К.Дж., Сьюэлл В.А., Коллинз А.М. О многих полиморфизмах генов тяжелых цепей IGHV человеческого иммуноглобулина сообщалось ошибочно. Иммунол Селл Биол. 2008;86(2):111–5. Эпублик 27 ноября 2007 г. пмид: 18040280.
  5. 5. Ральф Д.К., Матсен Ф.А. Вывод зародышевой линии иммуноглобулина для каждого образца на основе данных глубокого секвенирования рецептора В-клеток. 2017. Архив: 1711.05843v2.
  6. 6. Яари Г., Удуман М., Кляйнштейн С.Х. Количественная селекция в наборах данных высокопроизводительного секвенирования иммуноглобулинов.Нуклеиновые Кислоты Res. 2012;40(17):e134. Эпб 2012/05/27. пмид: 22641856; Центральный PMCID в PubMed: PMC3458526.
  7. 7. Маккой К.О., Бедфорд Т., Минин В.Н., Брэдли П., Робинс Х., Матсен Ф.А. Количественная оценка эволюционных ограничений на созревание аффинности В-клеток. Philos Trans R Soc Lond B Biol Sci. 2015;370(1676). пмид: 26194758; Центральный PMCID в PubMed: PMC4528421.
  8. 8. Куи А., Ди Ниро Р., Вандер Хайден Дж. А., Бриггс А. В., Адамс К., Гилберт Т. и др. Модель нацеливания на соматическую гипермутацию у мышей на основе данных высокопроизводительного секвенирования Ig.Дж Иммунол. 2016;197(9):3566–74. Эпб 2016/10/05. пмид: 27707999; Центральный PMCID в PubMed: PMC5161250.
  9. 9. Watson CT, Breden F. Локус тяжелой цепи иммуноглобулина: генетическая изменчивость, недостающие данные и последствия для болезней человека. Гены Иммун. 2012;13(5):363–73. Эпб 2012/05/03. пмид: 22551722.
  10. 10. Parameswaran P, Liu Y, Roskin KM, Jackson KK, Dixit VP, Lee JY и др. Сигнатуры конвергентных антител при лихорадке денге человека. Клеточный микроб-хозяин. 2013;13(6):691–700.пмид: 23768493; Центральный PMCID в PubMed: PMC4136508.
  11. 11. Chang CJ, Chen CH, Chen BM, Su YC, Chen YT, Hershfield MS, et al. Полногеномное ассоциативное исследование идентифицирует новый локус чувствительности к иммуногенности полиэтиленгликоля. Нац коммун. 2017;8(1):522. Эпб 2017/09/12. пмид: 285; Центральный PMCID в PubMed: PMC5595925.
  12. 12. Бойд С.Д., Лю Ю., Ван С., Мартин В., Данн-Уолтерс Д.К. Репертуар лимфоцитов человека при старении. Курр Опин Иммунол. 2013;25(4):511–5.Эпб 2013/08/28. пмид: 239; Центральный PMCID в PubMed: PMC4811628.
  13. 13. Kidd MJ, Chen Z, Wang Y, Jackson KJ, Zhang L, Boyd SD, et al. Вывод поэтапных гаплотипов для локусов генов V-области H-цепи иммуноглобулина путем анализа реаранжировок генов VDJ. Дж Иммунол. 2012;188(3):1333–40. Эпублик 28.12.2011. пмид: 22205028; Центральный PMCID в PubMed: PMC4734744.
  14. 14. Авнир Ю., Уотсон К.Т., Гланвилл Дж., Петерсон Э.К., Талларико А.С., Беннетт А.С. и соавт. Полиморфизм IGHV1-69 модулирует репертуар антител против гриппа, коррелирует со сдвигами в использовании IGHV и зависит от этнической принадлежности.Научный доклад 2016; 6: 20842. Эпб 2016/02/16. пмид: 26880249; Центральный PMCID в PubMed: PMC4754645.
  15. 15. Лефранк М.П., ​​Джудичелли В., Гинесту С., Джабадо-Михалуд Дж., Фолч Г., Белласен Ф. и др. IMGT, международная информационная система ImMunoGeneTics. Нуклеиновые Кислоты Res. 2009; 37 (выпуск базы данных): D1006–12. Эпублик 31.10.2008. пмид: 18978023; Центральный PMCID в PubMed: PMC2686541.
  16. 16. Коллинз А.М., Ван Ю, Роскин К.М., Маркиз С.П., Джексон К.Дж. Репертуар тяжелых цепей мышиных антител сосредоточен на зародышевой линии и сильно варьирует между инбредными штаммами.Philos Trans R Soc Lond B Biol Sci. 2015;370(1676). пмид: 26194750; Центральный PMCID в PubMed: PMC4528413.
  17. 17. Мюлдерманс С, Смидер ВВ. Различные виды антител: структурные различия, создающие терапевтические возможности. Курр Опин Иммунол. 2016;40:7–13. Эпб 2016/02/27. пмид: 26

    5; Центральный PMCID в PubMed: PMC4884505.

  18. 18. де лос Риос М., Крискителло М.Ф., Смидер В.В. Структурное и генетическое разнообразие в репертуарах антител разных видов. Curr Opin Struct Biol.2015;33:27–41. Эпб 2015/07/17. пмид: 26188469.
  19. 19. Луо С., Ю Дж. А., Ли Х., Сонг Ю. С. Глобальная генетическая изменчивость семейств генов иммунных рецепторов IGHV и TRBV у людей. Альянс наук о жизни. 2019;2(2). Эпаб 2019/02/26. пмид:30808649; Центральный PMCID в PubMed: PMC63.
  20. 20. Yu Y, Ceredig R, Seoighe C. База данных аллелей иммунных рецепторов человека, восстановленных из данных секвенирования населения. Дж Иммунол. 2017;198(5):2202–10. Эпб 2017/01/23. пмид: 28115530.
  21. 21. Watson CT, Matsen FA, Jackson KJL, Bashir A, Smith ML, Glanville J, et al. Комментарий к «Базе данных аллелей иммунных рецепторов человека, восстановленных из данных секвенирования населения». Дж Иммунол. 2017;198(9):3371–3. пмид: 28416712.
  22. 22. Бойд С.Д., Гаэта Б.А., Джексон К.Дж., Файр А.З., Маршалл Э.Л., Меркер Д.Д. и др. Индивидуальная вариация в репертуаре генов Ig зародышевой линии, выведенная из реаранжировок генов вариабельной области. Дж Иммунол. 2010;184(12):6986–92. Эпб 2010/05/21.пмид: 20495067; Центральный PMCID в PubMed: PMC4281569.
  23. 23. Гадала-Мария Д., Яари Г., Удуман М., Кляйнштейн С.Х. Автоматизированный анализ данных высокопроизводительного секвенирования В-клеток выявил высокую частоту новых аллелей сегмента V гена иммуноглобулина. Proc Natl Acad Sci U S A. 2015;112(8):E862–70. Эпб 2015/02/09. пмид: 25675496; Центральный PMCID в PubMed: PMC4345584.
  24. 24. Corcoran MM, Phad GE, Vázquez Bernat, Stahl-Hennig C, Sumida N, Persson MA, et al. Создание индивидуализированных баз данных генов V показывает высокий уровень генетического разнообразия иммуноглобулинов.Нац коммун. 2016;7:13642. Эпублик от 20.12.2016. пмид: 27995928; Центральный PMCID в PubMed: PMC5187446.
  25. 25. Zhang W, Wang IM, Wang C, Lin L, Chai X, Wu J и др. IMPre: точное и эффективное программное обеспечение для прогнозирования генов и аллелей зародышевых рецепторов Т- и В-клеток на основе данных реаранжированного репертуара. Фронт Иммунол. 2016;7:457. Эпублик 2016/11/04. пмид: 27867380; Центральный PMCID в PubMed: PMC5095119.
  26. 26. Гадала-Мария Д., Гидони М., Маркес С., Вандер Хейден Дж. А., Кос Дж. Т., Уотсон К. Т. и соавт.Идентификация предметно-специфических аллелей иммуноглобулина по данным секвенирования экспрессированного репертуара. Фронт Иммунол. 2019;10:129. Эпаб 2019/02/13. пмид:30814994; Центральный PMCID в PubMed: PMC6381938.
  27. 27. Хасс М., Вейл А.М., Берроуз П.Д., Шредер Х.В. Последовательности, кодируемые разнообразием иммуноглобулинов (D. Immunol Rev. 2018; 284(1):106–19. pmid:29944758.
  28. 28. Сафонова Ю., Певзнер П.А. Вывод генов разнообразия и анализ неканонической рекомбинации V(DD)J в иммуноглобулинах.Фронт Иммунол. 2019;10:987. Эпублик 2019/05/03. пмид:31134072; Центральный PMCID в PubMed: PMC6516046.
  29. 29. Торнквист Л., Олин М. Важные шаги для компьютерного вывода о 3′-конце новых аллелей вариабельных генов тяжелой цепи иммуноглобулина, проиллюстрированных аллелем IGHV3-7. Мол Иммунол. 2018; 103:1–6. Эпб 2018/08/30. пмид:30172112.
  30. 30. Ohlin M, Scheepers C, Corcoran M, Lees WD, Busse CE, Bagnara D, et al. Предполагаемые аллельные варианты генов рецепторов иммуноглобулинов: система их оценки, документирования и наименования.Фронт Иммунол. 2019;10:435. Эпб 2019/03/18. пмид:30936866; Центральный PMCID в PubMed: PMC6431624.
  31. 31. Митценмахер М. Обзор результатов для каналов удаления и связанных с ними каналов синхронизации. Вероятностные опросы. 2009; 6: 1–33.
  32. 32. Левин М., Левандер Ф., Палмасон Р., Грейфф Л., Олин М. Репертуары костного мозга и периферической крови, кодирующие антитела, — фокус на IgE. J Аллергия Клин Иммунол. 2017;139(3):1026–30. Эпб 2016/08/09. пмид: 27521279.
  33. 33.Эллебеди А.Х., Джексон К.Дж., Киссик Х.Т., Накая Х.И., Дэвис К.В., Роскин К.М. и др. Определение антигенспецифических субпопуляций плазмобластов и В-клеток памяти в крови человека после вирусной инфекции или вакцинации. Нат Иммунол. 2016;17(10):1226–34. Эпб 2016/08/15. пмид: 27525369; Центральный PMCID в PubMed: PMC5054979.
  34. 34. Гупта Н.Т., Адамс К.Д., Бриггс А.В., Тимберлейк С.К., Виньо Ф., Кляйнштейн С.Х. Иерархическая кластеризация может идентифицировать клоны В-клеток с высокой степенью достоверности данных секвенирования репертуара Ig.Дж Иммунол. 2017;198(6):2489–99. Эпб 2017/02/08. пмид: 28179494; Центральный PMCID в PubMed: PMC5340603.
  35. 35. Friedensohn S, Lindner JM, Cornacchione V, Iazeolla M, Miho E, Zingg A, et al. Синтетические стандарты в сочетании с коррекцией ошибок и предвзятости повышают точность и количественное разрешение секвенирования репертуара антител в наивных человеческих клетках и В-клетках памяти. Фронт Иммунол. 2018;9:1401. Эпаб 2018/06/20. пмид: 29973938; Центральный PMCID в PubMed: PMC6019461.
  36. 36. Магри Г., Комерма Л., Пибус М., Синтес Дж., Ллиге Д., Сегура-Гарсон Д. и др.Секреторный IgM человека возникает из плазматических клеток, клонально связанных с В-клетками памяти кишечника, и нацелен на весьма разнообразные комменсалы. Иммунитет. 2017;47(1):118–34.e8. Эпублик от 11.07.2017. пмид: 28709802; Центральный PMCID в PubMed: PMC5519504.
  37. 37. Стерн Дж. Н., Яари Г., Вандер Хейден Дж. А., Черч Г., Донахью В. Ф., Хинтцен Р. К. и др. В-клетки, населяющие мозг рассеянного склероза, созревают в дренирующих шейных лимфатических узлах. Sci Transl Med. 2014;6(248):248ra107. пмид: 25100741; Центральный PMCID в PubMed: PMC4388137.
  38. 38. Грейфф В., Мензель У., Михо Э., Вебер С., Ридель Р., Кук С. и др. Системный анализ показывает высокую генетическую и антиген-зависимую предопределенность репертуаров антител на протяжении всего развития В-клеток. Cell Rep. 2017;19(7):1467–78. пмид: 28514665.
  39. 39. Li X, Duan X, Yang K, Zhang W, Zhang C, Fu L и др. Сравнительный анализ иммунного репертуара между обычными антителами двугорбого верблюда и антителами с тяжелой цепью. ПЛОС Один. 2016;11(9):e0161801. Эпб 2016/09/02.пмид: 27588755; Центральный PMCID в PubMed: PMC5010241.
  40. 40. VanDuijn MM, Dekker LJ, van IJcken WFJ, Sillevis Smitt PAE, Luider TM. Иммунный репертуар после иммунизации глазами секвенирования нового поколения и протеомики. Фронт Иммунол. 2017;8:1286. Эпублик 2017/10/16. пмид: 263; Центральный PMCID в PubMed: PMC5650670.
  41. 41. Банерджи С., Ши Х., Банасик М., Мун Х., Лис В., Цинь И. и др. Оценка новой стратегии мультииммуногенной вакцины для нацеливания на нейтрализующие эпитопы 4E10/10E8 на проксимальной внешней области мембраны gp41 ВИЧ-1.Вирусология. 2017;505:113–26. Эпаб 2017/02/23. пмид: 28237764; Центральный PMCID в PubMed: PMC5385849.
  42. 42. Шлемов А., Банкевич С., Бзикадзе А., Турчанинова М.А., Сафонова Ю., Певзнер П.А. Реконструкция репертуаров антител из склонных к ошибкам считываний иммуносеквенирования. Дж Иммунол. 2017;199(9):3369–80. Эпб 2017/10/04. пмид: 28978691; Центральный PMCID в PubMed: PMC5661950.
  43. 43. Кидд М.Дж., Джексон К.Дж., Бойд С.Д., Коллинз А.М. Спаривание DJ во время рекомбинации VDJ показывает позиционные предубеждения, которые различаются среди людей с разными иммуногенотипами локуса IGHD.Дж Иммунол. 2016;196(3):1158–64. Эпублик 23.12.2015. пмид: 26700767; Центральный PMCID в PubMed: PMC4724508.
  44. 44. Кирик У., Грейфф Л., Левандер Ф., Олин М. Параллельный анализ генов зародышевой линии антител и анализ гаплотипов подтверждают достоверность вывода и открытия генов зародышевой линии иммуноглобулина. Мол Иммунол. 2017;87:12–22. Эпб 2017/04/04. пмид: 28388445.

границ | Соединения ближнего и дальнего действия по-разному модулируют динамику и состояние сетей малого мира

Введение

Считается, что человеческий мозг содержит миллиарды нейронов, плотно связанных друг с другом на коротких и длинных пространственных расстояниях (von Bartheld et al., 2016). Паттерн активности нейронов зависит от анатомической и функциональной среды, в которой она генерируется и в которой распространяется (рис. 1) (Wolfram, 1984a,b; Perc, 2007; Wang et al., 2010). В гипотетической решетке, где узлы строго упорядочены и не имеют коротких путей на большие расстояния, сигналы, как правило, затухают локально из-за сопротивления, которое высокое расстояние между узлами оказывает глобальной передаче (Shew and Plenz, 2012). Это контрастирует с более неупорядоченными графами, где сигналы, как правило, преобладают над глобальной сетью из-за плотной взаимосвязи.Между тем, в «маленьком мире » сети , образованной путем интеграции всего нескольких коротких путей дальнего действия в упорядоченную решетку (Watts and Strogatz, 1998), сигналы имеют тенденцию отражаться, взгромоздившись на краю хаоса в так называемом называют « критическим» состоянием (Шью и Пленз, 2012; Ким и Лим, 2015). Интересно, что считается, что функциональная топология мозга стремится к этой критичности (Takagi, 2018), гибко маневрируя ею исходя из неотложных оперативных потребностей; путем динамического вовлечения или отказа от функциональных связей ближнего и дальнего действия, например.g., благодаря когерентности нейроэлектрических колебаний (Singer, 1999; Buzsaki, 2006; Akam and Kullmann, 2014) или нейропластичности (Dan and Poo, 2004; Shin and Kim, 2006) мозг маневрирует сгруппированными и неупорядоченными топологическими фазами, настроенными на локальные и глобальные операционные интервалы соответственно. В этих теоретических рамках динамика мозга, по сути, отражает диалектику, с одной стороны, доводя мозг до его топологических крайностей (Poil et al., 2012; Shew and Plenz, 2012; Hesse and Gross, 2014), а с другой — руку, удерживая ее вблизи критического состояния (Shin, Kim, 2006; Hesse, Gross, 2014; Priesemann, 2015; Takagi, 2018).Считается, что работа вблизи критичности дает несколько нейровычислительных преимуществ, например, широкий динамический диапазон, эффективную информационную емкость и точность передачи информации. В свою очередь, предполагается, что отклонения от критичности лежат в основе различных невропатологий, таких как посттравматическая эпилепсия и расстройства сознания (Colombo et al., 2016). Несомненно, нарушение функциональных связей дальнего и ближнего действия в результате травмы или иным образом может иметь катастрофические последствия для динамики мозга (Pevzner et al., 2016). В этой статье Original Research мы конкретно исследуем, как соединения дальнего и ближнего действия влияют на топологические и динамические свойства сети маленького мира. Наши результаты показывают, что короткие связи формируют динамику системы, тогда как дальние связи определяют ее состояние . Мы обсуждаем последствия этих дифференциальных эффектов для клинической нейромодуляции.

Рисунок 1 . Топология маленького мира.Верхняя панель: случайным образом переписывая упорядоченную решетку, она постепенно переходит в неупорядоченный граф. Внутри этого перехода расположение маленького мира определяет критическое состояние. Зеленый: кластеры. Желтый: соединения ближнего действия. Синий: дальние соединения. Красный: кратчайший путь между узлами x и y . Нижняя панель: с увеличением случайности степень разделения между узлами в сети быстро уменьшается (красный цвет), при этом кластеризация остается практически неизменной в широких пределах (зеленый цвет).Топология маленького мира соответствует пунктирной области, содержащей свойства высокой кластеризации и низкого разделения.

Методы

Параметры модели см. в таблице 1.

Таблица 1 . Параметры модели.

Генерация сети

Чтобы сохранить управляемое количество свободных параметров и уменьшить артефакты граничных условий, мы ограничили наш анализ моделью порождающей кольцевой сети, основанной на модели маленького мира Уоттса и Строгаца (1998).Эти кольцевые сети были сгенерированы с использованием пользовательского кода Python на основе модуля с открытым исходным кодом networkx . Вкратце, каждый из 92 374 N 92 375 = 1000 узлов был подключен к своим 92 374 h 92 375 ближайшим соседям, что обозначало «92 374 ближних 92 375» соединений (для 92 374 h 92 375 значительно ниже насыщения, 92 374 h 92 375 < < 92 374 N 92 375 ). Далее каждый узел в среднем получил дополнительный набор из 92 374 g 92 375 случайных, но уникальных проводов, которые были обозначены как «92 374 дальних 92 375» соединений (поскольку провода 92 374 g 92 375 не равнялись проводам 92 374 h 92 375).Конкретно, дальняя связность g была создана вложенным циклом, заданным как g = T × u , где T — максимальное количество дополнительных проводов на узел, а u — среднее значение. часть из них сработала. Чтобы аппроксимировать биологические соотношения серого и белого вещества, сохранив связный граф, мы сохранили диапазон связей ближнего действия примерно в 10 раз больше, чем связей дальнего действия (Bajada et al., 2019; Mota et al., 2019).

Наконец, каждая сеть была определена своей матрицей смежности, A mn , которая использовалась для анализа моделирования сети (см. Модель связанных осцилляторов Курамото).

Коэффициент маленького мира

Чтобы количественно оценить степень сходства сети с сетью маленького мира, мы вычислили коэффициент маленького мира ω (Telesford et al., 2011). По сути, коэффициент маленького мира сравнивает сходство сети с идеально упорядоченным и совершенно неупорядоченным расположением в зависимости от степени, в которой узлы сети сгруппированы, и степени, в которой они разделены. Коэффициент маленького мира определяется как:

ω = LнеупорядоченныйL-Cупорядоченный,

, где L — средняя длина кратчайшего пути между узлами в сети, а C — степень кластеризации (рис. 1).Неупорядоченные и упорядоченные сети были сгенерированы на основе связности на большие расстояния, определяемой как g = T × u (см. Генерация сети). Для идеально упорядоченной сети не было добавлено дальних связей, таким образом, u = 0 и, следовательно, g = 0. Для совершенно неупорядоченной сети было введено максимальное количество дальнодействующих связей, таким образом, u = 1 и, следовательно, g = T .

Параметры сети C и L были рассчитаны с использованием обычных методов теории графов.Конкретно, кластеризация C была вычислена как транзитивность сети , так что:

, где ∇ — количество замкнутых троек в сети, а Tr — максимальное количество троек. Средняя длина кратчайшего пути L была определена как:

L= ∑s,t∈VD(s,t) N(N-1),

, где V — множество узлов в сети, D(s,t) — длина кратчайшего пути от узла s до t , а N — общее количество узлов.Таким образом, когда разделение сетей L L неупорядоченных и кластеризация сетей C < < C упорядочены , что означает, что ω ≈ аппроксимирует коэффициент сети , совершенно неупорядоченный граф. Аналогично, для идеально упорядоченной решетки, когда сетевое кластери- .Важно отметить, что топология малого мира определяется как критическое состояние, обладающее обоими качествами, а именно кластеризацией сети, аналогичной упорядоченной решетке C C упорядоченным , и разделением сети подобно неупорядоченному графу L L неупорядоченный ; таким образом, коэффициент малого мира стремится к ω ≈ 0 по мере того, как сеть стремится к критическому расположению малого мира.

Модель связанных осцилляторов Курамото

Каждый узел сети был смоделирован как связанный осциллятор типа Курамото (Yamamoto et al., 2018), описываемый набором N -связанных дифференциальных уравнений (Breakspear et al., 2010):

θ∙n=εn+KN∑m=1NAmnsin(θm-θn), n=1, …, N,

где n th осциллятор с собственной частотой ε n регулирует свою фазовую скорость θ∙n на основе парных фазовых взаимодействий со своими связанными аналогами (обеспечивается матрицей смежности A 9 , см. Генерация сети). Межузловая связь была K = 3, а собственные частоты были распределены в соответствии с гауссовой плотностью вероятности со средним значением ε 0 = 0.Таким образом, состояние узла ( n = 1, …, N ) определялось его фазой θ, которая вычислялась методом Ливерморского решателя обыкновенных дифференциальных уравнений (LSODA) с динамическим временным шагом.

Степень синхронности в сети определялась параметром порядка r , определяемым как:

r(θm)=reiψ=1N∑m=1Neiθm,

, где ψ — средняя фаза набора осцилляторов N , а скаляр r представляет порядок или фазовую однородность сети.Реализация колебательной системы Курамото с открытым исходным кодом на Python доступна в Интернете и использовалась для создания представленных здесь данных моделирования (Damicelli, 2021).

Анализ стабильности и привлекательности

Чтобы вычислить устойчивость различных состояний сети, мы устанавливаем начальный уровень синхронности сети через начальные узловые фазы θ m 0 . Так, при начальной синхронности r 0 = 0,5 в среднем 50% узлов сети имели в исходном состоянии равные фазы.Затем на заданном временном шаге ∆ t = 250, не обязательно в стационарном состоянии, вычислялось отклонение сети от начального уровня синхронности, выявляя устойчивость начального состояния. В частности, большие отклонения отражают более слабую стабильность. Повторение этого процесса для всех комбинаций начальных уровней синхронизации и параметров подключения дает тепловые карты стабильности, изображенные на рис. 4A .

Чтобы рассчитать привлекательность различных состояний сети, мы проверили, на какие уровни синхронизации перешли сети во время моделирования, и оценили конечный уровень синхронии на основе размера сдвига.Например, для начальной синхронизации r 0 = 0,5 и связи на большом расстоянии g = 0,001 одна сеть может оказаться на конечном уровне синхронизации r 1 = 0,0. Это добавляет s = |r 0 r 1 | = 0,5 до конечного состояния синхронизации r 1 . Синхронные состояния, имеющие самые высокие кумулятивные баллы, имели наибольшую привлекательность. Повторение этого процесса для всех комбинаций начальных уровней синхронности и параметров связности дает тепловые карты привлекательности, приведенные в Рисунок 4B .

Результаты

Чтобы изучить влияние соединений дальнего и ближнего действия на топологические и динамические свойства сети малого мира, мы применили вариант модели маленького мира Уоттса и Строгаца (1998) и модель связанных осцилляторов Курамото ( Курамото, 1984). Конкретно, мы сгенерировали упорядоченную кольцевую решетку, состоящую из N = 1000 узлов, каждый узел соединен со своими h ближайшими соседями. К этой базе мы добавили в среднем g уникальных дальних подключений на узел.Таким образом, по определению, соединения дальнего действия g топологически отличаются от своих коррелятов ближнего действия h , что справедливо для соединений ближнего действия значительно ниже насыщения сети, h < < N . Затем, чтобы количественно оценить степень сходства сети с сетью маленького мира, мы вычислили коэффициент маленького мира ω (Telesford et al., 2011). По сути, коэффициент маленького мира сравнивает сходство сети с идеально упорядоченной сетью.совершенно неупорядоченное расположение, основанное на степени, в которой узлы сети сгруппированы, и степени, в которой они разделены. Более конкретно, упорядоченные подкритических решеток стремятся к ω ≈ – 1 , имея высокие параметры кластеризации и высокого разделения; неупорядоченные, сверхкритические графы стремятся к ω ≈ + 1 , имеющие низкие параметры кластеризации и низкого разделения; и критических топологий малого мира имеют тенденцию к ω ≈ 0 , имея сбалансированные как упорядоченные, так и неупорядоченные тенденции (см. Методы).В рамках этого определения мы визуализировали топологическое поведение сети, построив коэффициент малого мира ω как функцию связи дальнего и ближнего действия g и h соответственно (рис. 2). Наконец, мы использовали ту же топологическую структуру для создания сетей связанных осцилляторов типа Курамото (Курамото, 1984).

Рисунок 2 . Небольшой мир сетей с различными значениями связности дальнего и ближнего действия. (A) Коэффициенты маленького мира на графике N = 1000 со статической связью ближнего действия H = 10, 50, 100, усредненные по 100 выборкам, показаны на полулогарифмической оси x.Вставка, показанная по нелогарифмической оси x. Вертикальные пунктирные линии представляют границы критического режима для сетей H = 10 и H = 100. Обратите внимание, что критичность уменьшается по мере уменьшения статической связности ближнего действия. (B) Коэффициенты маленького мира на графике N = 1000 со статической связностью на большом расстоянии G ( G ≈ 0,001, 0,03, 0,8, 10), усредненные по 100 выборкам. Обратите внимание, что кривые состояния ближнего действия сходятся к критическому состоянию, несмотря на базовую статическую связность дальнего действия G . (C) Первая производная кривых состояния, показанных на рисунках A и B, представляет собой подвижность состояния сети, т. е. насколько хорошо она переходит из одного топологического состояния в другое. Обратите внимание, что модуляция соединений ближнего действия h обеспечивает почти нулевую мобильность топологического состояния по сравнению с модуляцией соединений дальнего действия g . Мобильность топологического состояния в основном находится в докритических и критических пространствах, оставляя почти нулевую мобильность при высоких значениях связности. (D) Разница в подвижности состояний между сетями со статической связью ближнего действия H = 10 и H = 100. На диаграмме видно, что топологическое состояние стабилизируется в докритическом пространстве (отрицательные значения) и дестабилизируется вблизи критичности (положительные значения). Обратите внимание, что все графики имеют логарифмическую ось X. Точки данных представляют собой среднее ± стандартная ошибка среднего.

Соединения дальнего действия доминируют в топологическом состоянии

Сначала мы рассмотрели роль соединений ближнего и дальнего действия в определении топологического состояния сети, в частности, сохраняя один параметр статическим (заглавные буквы H и G ) при модуляции другого (строчные буквы h и г ) (рис. 2).Мы обнаружили, что модуляции связи дальнего действия g обеспечивают почти полный топологический диапазон, несмотря на лежащую в основе статическую связь ближнего действия H (рис. 2А; ~ 70% ± 0,05; среднее значение ± стандартная ошибка среднего). Тем не менее, обратное не имело место: инвариант к базовой связности G дальнего действия, увеличение связности ближнего действия h все сходились к критическому состоянию (рис. 2A, B). В общем, менее половины топологического диапазона было достигнуто только модуляцией ближнего действия.Таким образом, короткодействующие связи, по-видимому, плохо подходят в качестве модулятора топологического состояния.

Для дальнейшего исследования мы вычислили первую производную топологического состояния, чтобы выявить подвижность состояния Δω сети, т. е. насколько легко сеть перешла из одного топологического состояния в другое посредством изменений параметров связности ч и г (рис. 2С). Мы обнаружили, что во всех базовых связях G дальнего действия модуляция связности ближнего действия h практически не влияла на топологическое состояние.Модуляция дальнего соединения g сети, однако, предлагала мощную мобилизацию состояний в докритических и критических режимах, но почти нулевую мобильность, приближающуюся к сверхкритическому состоянию. Доминирующая роль дальнодействующих связей в топологическом состоянии была подтверждена анализом доминантности ( R 2 ~ 0,648 для дальнодействующих против R 2 2 ~ 0,003 для ближнедействующих связей).

Вместе эти результаты показывают, что топологическое состояние сети малого мира в основном определяется связью на большие расстояния (Watts and Strogatz, 1998) и что топологическая мобильность сети наиболее сильна намного ниже сверхкритического состояния (Carhart-Harris). и другие., 2014).

Соединения ближнего действия формируют топологическую динамику

Затем мы оценили, как базовая связь ближнего действия H влияет на топологическое поведение сети, что отражено в форме кривых топологического состояния (рис. 2). Мы обнаружили, что по мере того, как статическая ближняя связность H уменьшалась, кривая состояния круче около критической точки, таким образом, сжимаясь и « сдвигая вправо » критический режим к более высоким значениям дальней связности g (рис. 2А).Это указывает на то, что для поддержания критичности малого мира слабо кластеризованные сети (низкий уровень H ) должны интегрировать соединения дальнего действия в большей степени, но в более узких пределах.

Затем мы рассчитали разницу в мобильности состояний сетей с высокой статической связностью ближнего действия ( H = 100) и низкой статической связностью ближнего действия ( H = 10) (рис. 2C). На этом разностном графике отрицательные значения отражают снижение подвижности состояния сети, что по существу соответствует стабилизации топологического состояния (и, наоборот, для положительных значений).Интересно, что мы обнаружили, что по мере того, как статическая связность ближнего действия H уменьшалась, стабильность топологического состояния смещалась в подкритический режим, что сильно дестабилизировало критичность малого мира (рис. 2D). Это указывает на то, что ближняя связь сети оказывает фундаментальное влияние на стабильность сети в различных топологических режимах.

Синхронизация по сети

Чтобы расширить наши топологические выводы, мы изучили свойства синхронизации, предлагаемые сетями малого мира с различными параметрами связи ближнего и дальнего действия (рис. 3).С этой целью мы количественно определили глобальную синхронность сети в устойчивом состоянии, используя параметр порядка Курамото r , который отражает глобальную фазовую однородность узлов сети (см. Методы).

Рисунок 3 . Моделирование связанных осцилляторов Курамото в сетях малого мира. (A) Верхняя панель показывает активность сети во времени. Цветовая карта представляет фазу узлов (слабый: гиперполяризованный — сильный: деполяризованный). г , дальняя связь.Нижняя панель показывает глобальную синхронность сети во времени. Сетевая активность, отобранная на верхней панели, была нанесена на карту r( θ m ) , чтобы выявить сетевую синхронность/порядок r с учетом набора колебательных фаз θ m . Линии представляют собой отдельные испытания, закрашенные цветом для улучшения визуальной различимости. Красный, H = 10, низкая связь ближнего действия. Зеленый, H = 50, промежуточная связь ближнего действия.Синий, H = 100, высокая скорость связи на ближнем расстоянии. (B) На этой диаграмме, усредненной по 15 испытаниям, показана устойчивая синхронизация сети по мере увеличения возможности подключения на большие расстояния g . Точки данных представляют собой среднее значение ± стандартное отклонение от среднего значения. Заштрихованная область соответствует стандартному отклонению среднего значения, подогнанному к логистической функции. SD среднего эквивалентна метастабильности сети, определяя динамический режим, который способствует гибким узловым взаимодействиям без стагнации в фиксированных положениях (Hellyer et al., 2015). Параметры логистической кривой: a , минимальная синхронизируемость; б , критический уклон; d , максимальная синхронизируемость; H , связь ближнего действия. Красный, H = 10, низкая связь ближнего действия. Зеленый, H = 50, промежуточная связь ближнего действия. Синий, H = 100, высокая скорость связи на ближнем расстоянии.

Путем постепенной интеграции соединений дальнего действия в структуру сети наши симуляции показывают, что синхронизируемость резко достигает критической точки, в которой сеть переходит из состояния низкой синхронности в почти полную синхронность (рис. 3А).Такая «взрывная синхронизация», критический переход, характерна для связанных осцилляторов типа Курамото (Kuramoto, 1984; Gómez-Gardeñes et al., 2011; Boccaletti et al., 2016) и отражает топологическую критичность малых миров. сетей (рис. 1) (Watts and Strogatz, 1998).

Затем мы смоделировали синхронизируемость с помощью четырехпараметрической логистической регрессии (рис. 3B). Как и в наших топологических выводах, мы обнаружили, что наклон критического перехода b круче, поскольку статическая связь ближнего действия H была уменьшена, что указывает на дестабилизацию и сужение критического режима (рис. 3B, вставка).Минимальная синхронизируемость 92 374 и 92 375 сети, кроме того, связана пропорционально со статической связностью на ближнем расстоянии, указывая на то, что базовая синхронизация зависит отдельно от взаимодействия на ближнем расстоянии. Действительно, по мере того, как вводится больше соединений ближнего действия, сеть в конечном итоге достигает точки насыщения, когда глобальная синхронизация становится детерминированной, инвариантной к топологическим модуляциям (Barahona and Pecora, 2002).

Наконец, рассчитав отклонение сети от предопределенного начального уровня синхронизации (см. Методы), мы проверили стабильность и привлекательность различных состояний сети (рис. 4).Во-первых, эти данные подтверждают, что устойчивость критического режима сужается по мере уменьшения связности на малых расстояниях. Во-вторых, по мере удаления связей ближнего действия мы обнаруживаем, что сеть все больше притягивается к докритическим состояниям синхронии (рис. 4B), что согласуется с топологической дестабилизацией, способствующей подкритичности, представленной ранее ( cf . красные кривые на рисунках 2D, 4D). , и вставка).

Рисунок 4 . Стабильность сети. (A) Тепловая карта стабильности различных состояний сети.Обратите внимание на сужение устойчивости критического режима в разреженной сети H = 10 по сравнению с H = 50, 100, H , связность ближнего действия; г , дальняя связь; r , сетевая синхронизация; Синий, стабильный; Желтый, нестойкий. (B) Тепловая карта привлекательности различных состояний сети. Обратите внимание на повышенную привлекательность экстремальных режимов сети, особенно подкритичности, в разреженной сети H = 10. H , возможность подключения на короткие расстояния; г , дальняя связь; r , сетевая синхронизация; Синий, очень привлекательный; Желтый, менее привлекательный; Белый, непривлекательный. (C) Разница в привлекательности состояний между сетями с низким ( H = 10) и средним ( H = 50) малым радиусом действия. H , возможность подключения на короткие расстояния; г , дальняя связь; r , сетевая синхронизация; Красный, повышенная привлекательность; Зеленый, снижение привлекательности; Слабая, неизменная привлекательность. (D) Разница в привлекательности между по-разному сгруппированными сетями, имеющая в виду дальнюю связность g -оси. Обратите внимание на пик репеллентов на критической и докритической границе и докритическую впадину, которые вместе могут способствовать докритическому захвату. На вставке показаны данные основного участка в транспонированном виде A T , что делает его сходство с топологическим паттерном дестабилизации более ясным (рис. 2D). Красная пунктирная кривая показывает разницу в привлекательности разреженно сгруппированных H = 10 и плотно сгруппированных H = 100 сетей.Зеленая сплошная кривая показывает разницу в привлекательности сетей с разреженной кластеризацией H = 10 и промежуточной кластеризацией H = 100.

Метастабильность сети зависит от соединений ближнего действия

Наши данные показывают, что функциональные взаимодействия сети сходятся по мере того, как уменьшается статическая связь ближнего действия (рис. 3B, обратите внимание на сужение стандартного отклонения). Соответственно, мы обнаружили, что связность на большом расстоянии g в слабо кластеризованной сети (низкая H ) имеет очень высокую прогностическую силу (PPS) в отношении глобальной синхронности r сети, тогда как сильно кластеризованные сети (высокая H ) в целом плохо предсказуемы ( H = 10, PPS = 0.93; H = 100, PPS = 0,43) (Wetschoreck et al., 2020). Кроме того, по мере того, как ближняя связность сетей стремится к насыщению (от 92 374 H 92 375 до 92 374 N 92 375 = 1000), PPS падает до 0. Точнее, мы обнаруживаем, что PPS линейно пропорциональна ближней связности сетей. сеть (PPS = -0,010H + 0,985; R 2 = 0,99) (дополнительный рисунок 1).

PPS можно использовать для оценки метастабильности сети.Метастабильность, которая, как считается, присуща познанию (Alderson et al., 2020), определяет динамический режим, который обеспечивает гибкое взаимодействие узлов сети без застоя в фиксированных позициях (Hellyer et al., 2015). Таким образом, наши результаты показывают, что метастабильность сети линейно зависит от базовой связности ближнего действия (согласно анализу доминирования, R 2 = 0,438 для ближнего действия по сравнению с R 2 = 0,136 для дальнего действия). диапазонные связи). Эти данные моделирования в целом отражают наши топологические выводы, предполагая, что соединения ближнего действия имеют ключевое значение для системной динамики сети (рис. 4).

Обсуждение

Мы исследовали влияние соединений ближнего и дальнего действия на топологические и динамические свойства сети малого мира. Сходя с предыдущей работой (Watts and Strogatz, 1998), мы демонстрируем, во-первых, что дальнодействующие связи определяют топологическое и функциональное состояние сети. Во-вторых, мы показываем, что короткодействующие связи формируют динамику системы, т. е. стабильность системы в различных топологических режимах (рис. 2, 4).Вместе наши результаты свидетельствуют о том, что связи ближнего и дальнего действия играют разные роли в формировании поведения сети маленького мира.

Топологические свойства сети оказывают фундаментальное влияние на происходящую в ней деятельность (Strogatz, 2001). В нескольких работах, например, проанализировано распространение инфекционных заболеваний в сетях малого мира, обнаружив колебания между спорадическими эндемическими и самоподдерживающимися эпидемическими инфекционными циклами, основанными на сетевом беспорядке (Kuperman and Abramson, 2001; Rüdiger et al., 2020). Другие исследовали синхронизацию связанных осцилляторов на графиках маленького мира (Barahona and Pecora, 2002; Nishikawa et al., 2003). Позже такое моделирование было расширено для изучения корковых колебаний и нейропластичности (Майстренко и др., 2007; Брейкспир и др., 2010).

Человеческий мозг представляет собой сложную систему, поддерживаемую взаимодействием миллиардов нейронов в локальных и глобальных пространственных масштабах. Предыдущая работа показала, что функциональная топология мозга имеет тенденцию к критичности, подобной маленькому миру, которая сочетает в себе как локальные (докритические), так и глобальные (сверхкритические) свойства системы (Bassett and Bullmore, 2017; Takagi, 2018).Гипотеза о том, что мозг сохраняет близость к критическому состоянию, проистекает из предпосылки превосходной вычислительной способности приспосабливаться к быстро меняющимся операционным требованиям (Massobrio et al., 2015a). Однако существует мнение, что признаки критичности, например, степенные распределения, могут быть артефактами выборки (Touboul and Destexhe, 2010; Marsili et al., 2013), мультипликативным шумом (Sornette, 1998) или появляться из-за «скрытых переменных». ” не обязательно связано с топологией сети (Aitchison et al., 2016; Моррелл и др., 2021). Хотя исчерпывающий обзор выходит за рамки этого обсуждения (Beggs and Timme, 2012), мы отмечаем, что разнообразные данные подтверждают взаимосвязь между критической нейронной динамикой и топологиями маленького мира (Massobrio et al., 2015b; Tan and Cheong, 2017; Takagi, 2018) и наличие критических сигнатур в фМРТ человека (Kitzbichler et al., 2009), потенциалы локального поля (Petermann et al., 2009), данные спайков (Friedman et al., 2012), колебания мозга человека (Poil et al., 2008) и искусственные нейронные сети (Shin and Kim, 2006).Действительно, в соответствии с режимом, близким к критическому (Priesemann, 2015), мозг работает в широком динамическом диапазоне, который обеспечивает когнитивные функции высокого уровня посредством глобальной нейронной координации (Taylor et al., 2015) и состояния низкой активности, такие как анестезия (Brown et al., 2010) и, в некоторой степени, сон (Priesemann et al., 2013; Tagliazucchi and van Someren, 2017), отмеченные более слабыми и фрагментарными взаимодействиями вне локальной среды.

Считается, что нейронные колебания, или «мозговые волны», опосредуют связь нейронов ближнего и дальнего действия через высокочастотные и низкочастотные диапазоны волн соответственно (Kopell et al., 2000; Бужаки, 2006 г.; Тисинга и Сейновски, 2009). По сути, волновая интерференция колеблющихся нейронных популяций способствует избирательной передаче информации (Singer, 1999; Buzsaki, 2006; Akam and Kullmann, 2010). Таким образом, была выдвинута гипотеза о том, что нарушение таких нейронных взаимодействий может иметь пагубные последствия для системной динамики мозга (Uhlhaas and Singer, 2006; Pevzner et al., 2016). В согласии с этой предпосылкой наши результаты показывают, что нарушения возможности подключения к сети на малых расстояниях дестабилизируют критичность малого мира в пользу экстремальных сетевых режимов, т.е.е., под- и сверхкритичность (рис. 2D, 4C). Такой отход от критичности был связан с крупномасштабными сигнатурами фМРТ бессознательного состояния (Tagliazucchi et al., 2016).

Подкритические сети, как правило, представляют собой состояния десинхронизации и кластеризации, которые нарушают глобальную сетевую обработку, например, познание (Roozenbeek et al., 2013). Соответственно, наши симуляции показывают, что сети с разреженной кластеризацией и плохой связью ближнего действия демонстрируют слабую метастабильность (дополнительный рисунок 1), что коррелирует с дефицитом когнитивной гибкости (Hellyer et al., 2015).

Примечательно, что наш анализ стабильности показывает, что повреждение связи ближнего действия сети может привести к «отталкивающему пику», который эффективно блокирует критический режим, задерживая сетевую активность в подкритической впадине (рис. 4D). Такая «подкритическая ловушка» согласуется с поведенческой гетерогенностью стойких расстройств сознания (Giacino et al., 2014), например, с частичным сохранением когнитивной обработки, и теоретически поддерживает восстановление системной динамики, например.д., посредством короткодействующей нервной потенциации.

Сверхкритическая сеть, с другой стороны, имеет тенденцию к гиперсинхронии, в целом напоминающей состояние судорог (Szaflarski et al., 2014; Zimmern, 2020). Действительно, исследователи утверждают, что эпилептиформные припадки отражают критический-сверхкритический переход (Arviv et al., 2016; Bauer et al., 2017; Freestone et al., 2017), который недавно был подтвержден сильным электроэнцефалографическим признаком у пациентов-людей ( Scheffer et al., 2009; Maturana et al., 2020). Точно так же Герстер и соавт. сообщают, что искусственные нейронные осцилляторы на сверхкритических графиках малого мира отражают электроэнцефалографические эпилептические паттерны (Gerster et al., 2020). Таким образом, рефрактерность некоторых типов эпилепсии может отражать лежащую в основе дестабилизацию критического режима путем устранения связей ближнего действия, например, в результате корковой дисгенезии или травмы головного мозга (Semah et al., 1998). Интересно, что недавняя работа над моделью Курамото показала, что общие ограничения ресурсов приводят к тому, что в сети возникают самозавершающиеся сверхкритические эпизоды (Фролов и Храмов, 2021), что соответствует рецидивам эпилепсии.

Одним из потенциальных механизмов нарушения нейронных связей ближнего действия может быть повреждение ключевых узлов головного мозга, содержащих большой кумулятивный вес связей ближнего действия (Gratton et al., 2012; Zhou et al., 2012; Haimovici et al., 2012). и др., 2016; Юань и др., 2017). Действительно, было показано, что концентраторы, например поясная кора, играют важную роль в когнитивной деятельности (Fagerholm et al., 2015; Li et al., 2019) и оказывают глубокое влияние на функциональную связность смоделированных сетей (Aerts et al. ., 2016). Интересно отметить, что компенсация травмы может, таким образом, предсказуемо обеспечиваться рекрутированием или гиперактивностью плотных узловых областей, что широко предполагалось (Hillary et al., 2011, 2015; Tang et al., 2012; Iraji et al., 2012; Iraji et al., 2015; al., 2016), например, в компонентах сети режима по умолчанию (Zhou et al., 2012).

Наши результаты в целом поддерживают комбинаторные стратегии нейромодуляции, которые по-разному нацелены на нейронные связи ближнего и дальнего действия, чтобы нормализовать динамику системы и мобилизовать состояние системы, соответственно.Будущая работа будет нацелена на компоненты нейронной связи ближнего и дальнего действия, например, посредством фармакологической нейростимуляции через амантадин для преимущественного усиления низкочастотных колебаний мозга (Ott et al., 2018; Ma and Zafonte, 2020), стимуляции постоянным током глубоких мозговых структур, например тета гиппокампа (Lee et al., 2013), или модуляция гамма-излучения коры головного мозга (Pink et al., 2019), например, с использованием оптогенетической или фармакогенетической модуляции, специфичной для типа клеток (Liu et al., 2020), или неинвазивной транскраниальной магнитной стимуляции на низких частотах (Farzan et al., 2012).

Ограничения исследования

Это исследование имеет несколько ограничений. Во-первых, хотя кольцевая модель Уоттса и Строгаца обеспечивает полезную концептуальную основу, она не отражает реальную связность мозга, которая, как известно, содержит неслучайные распределения границ, например, «богатые концентраторы» (van den Heuvel and Sporns, 2011) и немасштабируемую связь. распределение степеней (Eguíluz et al., 2005). Тем не менее, редуцированные топологии, т.е.г., генеративные малые миры (Netoff et al., 2004; Perc, 2007; Tekin and Tagluk, 2017) и рандомизированные графы (van Vreeswijk and Sompolinsky, 1996; Tsodyks et al., 2000) остаются ценными для анализа нейронных сетей. предлагая контролируемую вычислительную среду с управляемыми параметрами и оптимизированными условиями сети.

Во-вторых, колебательная модель Курамото представляет собой сокращение сложных взаимодействий распределенных нейронных популяций (Singer, 1999; Buzsaki, 2006). Вполне вероятно, что более полные физиологические модели обеспечат более глубокое понимание точных механизмов таких нейронных взаимодействий.Однако в подтверждение применимости уравнений Курамото моделирование ранее применялось к макакам (Honey and Sporns, 2008) и к исследованиям человеческого мозга (Kitzbichler et al., 2009; Cabral et al., 2014), показывая высокую согласованность между данные моделирования и активность в состоянии покоя (Cabral et al., 2014; Vuksanovic and Hövel, 2014). В более широком смысле редуцированные модели (Siettos and Starke, 2016), такие как единицы с двумя состояниями (van Vreeswijk and Sompolinsky, 1996) и модель FitzHugh-Nagumo (Perc, 2007; Gerster et al., 2020), широко использовались для изучения сложного сетевого поведения, такого как самоорганизующиеся сбалансированные состояния (van Vreeswijk and Sompolinsky, 1996). Точно так же абстракция, предлагаемая моделью Курамото, позволяет проводить удобное моделирование и анализ, что имеет большое значение для исследования более фундаментальных принципов колебательной динамики (Breakspear et al., 2010), таких как рассматриваемое здесь функциональное разделение сетевых подключений.

Несмотря на эти ограничения, это исследование дает важные сведения о взаимосвязи между сетевым подключением и критической системной динамикой, которые в целом согласуются с эмпирическими отчетами и предыдущими работами (Haimovici et al., 2016). Будущие исследования должны применить данные коннектомии мозга и более полное моделирование сети, чтобы расширить эти результаты.

Заявление о доступности данных

Наборы данных, представленные в этом исследовании, можно найти в онлайн-репозитории: https://github.com/simonarvin/connectivity_smallworld.

Вклад авторов

SA и AG разработали проект. SA разработал проект, выполнил расчеты и проанализировал данные. SA, AG и KY интерпретировали данные и написали рукопись.Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Мы признательны за следующие гранты: Фонд Лундбек (DANDRITE-R248-2016-2518; R344-2020-300; и R351-2020-1095), Фонд Ново Нордиск (NNF20OC0064395) и Европейский исследовательский совет Starting (638730) гранты KY .

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Примечание издателя

Все претензии, изложенные в этой статье, принадлежат исключительно авторам и не обязательно представляют претензии их дочерних организаций или издателя, редакторов и рецензентов. Любой продукт, который может быть оценен в этой статье, или претензии, которые могут быть сделаны его производителем, не гарантируются и не поддерживаются издателем.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fncom.2021.783474/full#supplementary-material

Дополнительный рисунок 1. Прогностическая мощность подключения на большие расстояния g при сетевой синхронизации r . Предсказательная сила соединений дальнего действия для состояния синхронизации сети линейно пропорциональна связности сети ближнего действия. Фактически, поскольку связность ближнего действия H стремится к насыщению N = 1000, предсказательная сила стремится к 0. г , дальняя связь; r , сетевая синхронизация; H , возможность подключения на короткие расстояния; N , всего узлов; PPS , предсказательная сила.

Ссылки

Аэртс, Х., Фиас, В., Кайенбергс, К., и Маринаццо, Д. (2016). Мозговые сети под атакой: свойства устойчивости и влияние повреждений. Мозг 139, 3063–3083. дои: 10.1093/мозг/aww194

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Эйчисон, Л., Корради, Н., и Лэтэм, П.Е. (2016). Закон Ципфа возникает естественным образом, когда в основе лежат ненаблюдаемые переменные. PLoS-вычисление. биол. 12, е1005110. doi: 10.1371/journal.pcbi.1005110

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Акам, Т., и Куллманн, Д.М. (2014). Осцилляторное мультиплексирование популяционных кодов для избирательной коммуникации в мозгу млекопитающих. Нац. Преподобный Нейроски. 111–122. doi: 10.1038/nrn3668

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Алдерсон, Т.Х., Бокде, А.Л.В., Келсо, Дж.А.С., Магуайр, Л., и Койл, Д. (2020). Метастабильная нейронная динамика лежит в основе когнитивных функций во многих поведенческих парадигмах. Гум. Карта мозга. 41, 3212–3234. doi: 10.1002/hbm.25009

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Арвив О., Медведовский М., Шейнтух Л., Гольдштейн А. и Шрики О. (2016). Отклонения от критической динамики в межприступной эпилептиформной активности. J. Neurosci. 36, 12276–12292.doi: 10.1523/JNEUROSCI.0809-16.2016

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бахада, С. Дж., Шрайбер, Дж., и Касперс, С. (2019). Профилирование длины волокна: новый подход к структурной организации мозга. Нейроизображение 186, 164–173. doi: 10.1016/j.neuroimage.2018.10.070

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бауэр, П. Р., Тайс, Р. Д., Ламбертс, Р. Дж., Велис, Д. Н., Виссер, Г. Х., Толнер, Э. А., и другие. (2017). Динамика прекращения судорожного припадка и постиктальной генерализованной супрессии ЭЭГ. Мозг 140, 655–668. дои: 10.1093/мозг/aww322

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Боккалетти С., Альмендрал Дж. А., Гуан С., Лейва И., Лю З., Сендинья-Надаль И. и другие. (2016). Взрывные переходы в структуре и динамике сложных сетей: перколяция и синхронизация. Физ. Респ. 660, 1–94. doi: 10.1016/j.physrep.2016.10.004

Полнотекстовая перекрестная ссылка | Академия Google

Брейкспир, М., Хайтманн, С., и Даффертсхофер, А. (2010). Генеративные модели корковых колебаний: нейробиологические последствия модели Курамото. Фронт. Гум. Неврологи. 4, 190. doi: 10.3389/fnhum.2010.00190

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бужаки, Г. (2006). Ритмы мозга . Оксфорд, Великобритания; Нью-Йорк: Издательство Оксфордского университета.

Академия Google

Кабрал, Дж., Крингельбах, М.Л., и Деко, Г. (2014). Изучение сетевой динамики, лежащей в основе активности мозга во время отдыха. Прог. Нейробиол. 114, 102–131. doi: 10.1016/j.pneurobio.2013.12.005

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кархарт-Харрис, Р. Л., Лич, Р., Хеллиер, П. Дж., Шанахан, М., Фейлдинг, А., Тальязукки, Э., и соавт. (2014). Энтропический мозг: теория состояний сознания, основанная на исследованиях нейровизуализации с психоделическими препаратами. Фронт.Гум. Неврологи. 8, 20. doi: 10.3389/fnhum.2014.00020

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Коломбо, М. А., Вей, Ю., Рамаутар, Дж. Р., Линкенкер-Хансен, К., Тальязукки, Э., и Ван Сомерен, Э. Дж. В. (2016). Более тяжелые жалобы на бессонницу у людей с более сильными дальними временными корреляциями на ЭЭГ в состоянии покоя после пробуждения. Фронт. Физиол. 7, 576. doi: 10.3389/fphys.2016.00576

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Эгилус, В.М., Чиалво Д.Р., Чекки Г.А., Балики М. и Апкарян А.В. (2005). Функциональные сети мозга без масштабов. Физ. Преподобный Летт. 94, 018102. doi: 10.1103/PhysRevLett.94.018102

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Fagerholm, E.D., Hellyer, P.J., Scott, G., Leech, R., and Sharp, D.J. (2015). Отключение сетевых узлов и когнитивные нарушения после черепно-мозговой травмы. Мозг 138, 1696–1709. doi: 10.1093/мозг/awv075

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фарзан, Ф., Барр, М.С., Сан, Ю., Фицджеральд, П.Б., и Даскалакис, З.Дж. (2012). Транскраниальная магнитная стимуляция на модуляцию гамма-колебаний при шизофрении. Энн. Н. Я. акад. науч. 1265, 25–35. doi: 10.1111/j.1749-6632.2012.06543.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Friedman, N., Ito, S., Brinkman, B.A.W., Shimono, M., DeVille, R.E.L., Dahmen, K.A., et al. (2012). Универсальная критическая динамика в нейронных лавинных данных высокого разрешения. Физ. Преподобный Летт. 108, 208102. doi: 10.1103/PhysRevLett.108.208102

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фролов Н. и Храмов А. (2021). Экстремальные события синхронизации в модели Курамото: взаимодействие между ограничениями ресурсов и взрывными переходами. Хаос 31, 063103. doi: 10.1063/5.0055156

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Герстер М., Бернер Р., Савицки Ю., Захарова А., Шкох А., Глинка Дж. и соавт. (2020). Осцилляторы ФитцХью-Нагумо в сложных сетях имитируют явления синхронизации, связанные с эпилептическими припадками. Хаос 30, 123130. doi: 10.1063/5.0021420

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Джачино, Дж. Т., Финс, Дж. Дж., Лорейс, С., и Шифф, Н. Д. (2014). Расстройства сознания после приобретенной черепно-мозговой травмы: состояние науки. Нац. Преподобный Нейрол. 10, 99–114. doi: 10.1038/nrneurol.2013.279

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Гомес-Гарденьес, Дж., Гомес, С., Аренас, А., и Морено, Ю. (2011). Взрывные переходы синхронизации в безмасштабных сетях. Физ. Преподобный Летт. 106, 128701. doi: 10.1103/PhysRevLett.106.128701

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Граттон, К., Номура, Э.М., Перес, Ф., и Д’Эспозито, М. (2012). Очаговые поражения головного мозга в критических местах вызывают обширные нарушения модульной организации мозга. J. Cogn. Неврологи. 24, 1275–1285. дои: 10.1162/jocn_a_00222

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хаймовичи, А., Баленсуэла, П., и Тальязукки, Э. (2016). Динамические сигнатуры повреждения структурных связностей модели мозга при критическом состоянии. Мозговой контакт. 6, 759–771. doi: 10.1089/brain.2016.0455

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хеллиер П.Дж., Скотт Г., Шанахан М., Шарп Д. Дж. и Лич Р. (2015). Когнитивная гибкость за счет метастабильной нейронной динамики нарушается из-за повреждения структурного коннектома. J. Neurosci. 35, 9050–9063. doi: 10.1523/JNEUROSCI.4648-14.2015

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хиллари Ф.Г., Роман К.А., Венкатесан У., Райтмайер С.М., Бахо Р. и Кастелланос Н.Д. (2015). Гиперконнективность является фундаментальной реакцией на неврологические нарушения. Нейропсихология 29, 59–75. doi: 10.1037/neu0000110

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Hillary, F.G., Slocomb, J., Hills, E.C., Fitzpatrick, N.M., Medaglia, J.D., Wang, J., et al. (2011). Изменения в связности покоя во время восстановления после тяжелой черепно-мозговой травмы. Междунар. Дж. Психофизиол. 82, 115–123. doi: 10.1016/j.ijpsycho.2011.03.011

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ираджи, А., Chen, H., Wiseman, N., Welch, R.D., O’Neil, B.J., Haacke, E.M., et al. (2016). Компенсация через функциональную гиперсвязность: продольная оценка коннектома легкой черепно-мозговой травмы. Нейропласт. 2016, 4072402. doi: 10.1155/2016/4072402

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ким, С.-Ю., и Лим, В. (2015). Влияние связи маленького мира на быстрые редко синхронизированные корковые ритмы. Физ. Стат. мех. заявл. 421, 109–123. doi: 10.1016/j.physa.2014.10.019

Полнотекстовая перекрестная ссылка | Академия Google

Китцбихлер, М. Г., Смит, М. Л., Кристенсен, С. Р., и Буллмор, Э. (2009). Широкополосная критичность синхронизации сети человеческого мозга. PLoS-вычисление. биол. 5, е1000314. doi: 10.1371/journal.pcbi.1000314

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Копелл, Н., Эрментроут, Г.Б., Уиттингтон, М.А., и Трауб, Р.Д. (2000).Гамма-ритмы и бета-ритмы имеют разные свойства синхронизации. Проц. Нац. акад. науч. США 97, 1867. doi: 10.1073/pnas.97.4.1867

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Lee, D.J., Gurkoff, G.G., Izadi, A., Berman, R.F., Ekstrom, A.D., Muizelaar, J.P., et al. (2013). Глубокая стимуляция мозга тета-частотой ядра медиальной перегородки улучшает пространственную рабочую память после черепно-мозговой травмы. J. Neurotrauma 30, 131–139.doi: 10.1089/neu.2012.2646

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Li, F., Lu, L., Chen, H., Wang, P., Chen, Y.-C., Zhang, H., et al. (2019). Нарушение функционального узла головного мозга и причинно-следственной связи при острой легкой черепно-мозговой травме. Старение 11, 10684–10696. doi: 10.18632/aging.102484

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лю, Л., Сюй, Х., Ван, Дж., Ли, Дж., Тянь, Ю., Чжэн, Дж., и др. (2020). Типодифференциальная модуляция ГАМКергических интернейронов префронтальной коры при низком гамма-ритме и социальном взаимодействии. науч. Доп. 6, eaay4073. doi: 10.1126/sciadv.aay4073

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Майстренко Ю.Л., Лысянский Б., Гауптман С., Бурилко О. и Тасс П.А. (2007). Мультистабильность в модели Курамото с синаптической пластичностью. Физ. Преп. E Стат. Нонлин. Физика мягких веществ. 75, 066207. doi: 10.1103/PhysRevE.75.066207

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Марсили, М., Мастроматтео, И.и Руди, Ю. (2013). О выборке и моделировании сложных систем. arXiv arXiv:1301.3622. дои: 10.1088/1742-5468/2013/09/P09003

Полнотекстовая перекрестная ссылка | Академия Google

Массобрио, П., де Арканджелис, Л., Паскуале, В., Дженсен, Х. Дж., и Пленц, Д. (2015a). Критичность как признак здоровых нервных систем. Фронт. Сист. Неврологи. 9, 22. doi: 10.3389/fnsys.2015.00022

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Массобрио, П., Паскуале, В., и Мартинойя, С. (2015b). Самоорганизованная критичность в корковых сборках возникает в параллельных безмасштабных сетях и сетях малого мира. науч. 5, 10578. doi: 10.1038/srep10578

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Матурана, М.И., Мейзел, К., Делл, К., Кароли, П.Дж., Д’Суза, В., Грейден, Д.Б., и соавт. (2020). Критическое замедление как биомаркер предрасположенности к судорогам. Нац. коммун. 11, 2172. doi: 10.1038/с41467-020-15908-3

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Моррелл, М. К., Седерберг, А. Дж., и Неменман, И. (2021). Скрытые динамические переменные создают признаки пространственно-временной критичности в больших биологических системах. Физ. Преподобный Летт. 126, 118302. doi: 10.1103/PhysRevLett.126.118302

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мота, Б., Дос Сантос, С. Э., Вентура-Антунес, Л., Жардим-Месседер, Д., Neves, K., Kazu, R.S., et al. (2019). Объем белого вещества и соотношение белого и серого вещества у млекопитающих как следствие универсального масштабирования складок коры. Проц. Натл. акад. науч. США. 116, 15253–15261. doi: 10.1073/pnas.1716956116

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нетофф Т.И., Клюли Р., Арно С., Кек Т. и Уайт Дж.А. (2004). Эпилепсия в сетях маленького мира. J. Neurosci. 24, 8075–8083. дои: 10.1523/JNEUROSCI.1509-04.2004

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нишикава, Т., Моттер, А.Е., Лай, Ю.-К., и Хоппенстедт, Ф.К. (2003). Неоднородность в сетях осцилляторов: легче ли синхронизировать меньшие миры? Физ. Преподобный Летт. 91, 014101. doi: 10.1103/PhysRevLett.91.014101

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Отт, Т., Вестендорф, С., и Нидер, А. (2018). Рецепторы дофамина влияют на внутренние колебания во время обработки правил в префронтальной коре приматов. J. Cogn. Неврологи. 30, 770–784. дои: 10.1162/jocn_a_01248

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Перк, М. (2007). Влияние связности маленького мира на вызванный шумом временной и пространственный порядок в нейронных медиа. Солит Хаоса. Фракт. 31, 280–291. doi: 10.1016/j.chaos.2005.10.018

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Петерманн Т., Тиагараджан Т. С., Лебедев М. А., Николелис М.А.Л., Чиалво Д.Р. и Пленц Д. (2009). Спонтанная корковая активность бодрствующих обезьян, состоящая из лавин нейронов. Проц. Натл. акад. науч. США 106, 15921–15926. doi: 10.1073/pnas.0

9106

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Певзнер А., Изади А., Ли Д. Дж., Шахлаи К. и Гуркофф Г. Г. (2016). Создание волн в мозгу: что такое колебания и почему их модуляция имеет смысл при черепно-мозговой травме. Фронт. Сист.Неврологи. 10, 30–30. doi: 10.3389/fnsys.2016.00030

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Пинк, А. Э., Уильямс, К., Олдерман, Н., и Стоффельс, М. (2019). Использование повторяющейся транскраниальной магнитной стимуляции (rTMS) после черепно-мозговой травмы (TBI): предварительный обзор. Нейропсихология. Реабилитация . 31, 479–505. дои: 10.1080/09602011.2019.1706585

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Пойл, С.-С., Хардстоун Р., Мансвелдер Х.Д. и Линкенкер-Хансен К. (2012). Динамика критического состояния лавин и колебаний совместно возникает из сбалансированного возбуждения/торможения в нейронных сетях. J. Neurosci. 32, 9817–9823. doi: 10.1523/JNEUROSCI.5990-11.2012

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Poil, S.-S., van Ooyen, A., and Linkenkaer-Hansen, K. (2008). Лавинная динамика колебаний мозга человека: связь с критическими ветвящимися процессами и временными корреляциями. Гум. Карта мозга. 29, 770–777. doi: 10.1002/hbm.20590

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Приземанн, В., Вальдеррама, М., Вибрал, М., и Ле Ван Куен, М. (2013). Нейрональные лавины различаются от бодрствования до глубокого сна — свидетельство внутричерепных глубинных записей у людей. PLoS-вычисление. биол. 9, е1002985. doi: 10.1371/journal.pcbi.1002985

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Розенбек, Б., Маас, А.И.Р., и Менон, Д.К. (2013). Изменение закономерностей в эпидемиологии черепно-мозговой травмы. Нац. Преподобный Нейрол. 9, 231–236. doi: 10.1038/nrneurol.2013.22

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Рюдигер С., Плитч А., Сагес Ф., Соколов И. М. и Куртс Дж. (2020). Эпидемии с мутирующей заразностью в сетях малого мира. науч. Rep. 10, 5919. doi: 10.1038/s41598-020-62597-5

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шеффер, М., Bascompte, J., Brock, W.A., Brovkin, V., Carpenter, S.R., Dakos, V., et al. (2009). Сигналы раннего предупреждения о критических переходах. Природа 461, 53–59. doi: 10.1038/nature08227

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Semah, F., Picot, M.C., Adam, C., Broglin, D., Arzimanoglou, A., Bazin, B., et al. (1998). Является ли основная причина эпилепсии основным прогностическим фактором рецидива? Неврология 51, 1256–1262. doi: 10.1212/WNL.51.5.1256

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шин, К.-В., и Ким, С. (2006). Самоорганизованная критичность и безмасштабные свойства в возникающих функциональных нейронных сетях. Физ. Преп. E Стат. Нонлин. Физика мягких веществ. 74, 045101. doi: 10.1103/PhysRevE.74.045101

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сиеттос, К., и Старке, Дж. (2016). Многомасштабное моделирование динамики мозга: от одиночных нейронов и сетей до математических инструментов. Wiley Interdiscip. преп. сист. биол. Мед. 8, 438–458. дои: 10.1002/wsbm.1348

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шафлярски, Дж. П., Наззал, Ю., и Дреер, Л. Э. (2014). Посттравматическая эпилепсия: современные и перспективные методы лечения. Нейропсихиатр. Дис. Обращаться. 10, 1469–1477. doi: 10.2147/NDT.S50421

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Тальязукки Э., Кьялво Д. Р., Синячкин М., Amico, E., Brichant, J.-F., Bonhomme, V., et al. (2016). Крупномасштабные признаки бессознательного состояния согласуются с отходом от критической динамики. JR Soc. Интерфейс 13, 20151027. doi: 10.1098/rsif.2015.1027

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Тальязукки, Э., и ван Сомерен, Э. Дж. В. (2017). Крупномасштабная функциональная связь коррелирует сознания и возбуждения во время здорового и патологического цикла сна человека. Нейроизображение 160, 55–72. doi: 10.1016/j.neuroimage.2017.06.026

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Такаги, К. (2018). Принцип, основанный на информации, порождает топологию маленького мира и самоорганизующуюся критичность в крупномасштабной сети мозга. Фронт. вычисл. Неврологи. 12, 65. doi: 10.3389/fncom.2018.00065

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Тан, С.Ю., Ивз, Э., Дамс-О’Коннор, К., Ho, L., Leung, E., Wong, E., et al. (2012). Диффузная дисконнектность при ЧМТ: исследование fMri и Dti в состоянии покоя. Пер. Неврологи. 3, 9–14. doi: 10.2478/s13380-012-0003-3

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Тейлор, П., Хоббс, Дж. Н., Буррони, Дж., и Зигельманн, Х. Т. (2015). Глобальный ландшафт познания: иерархическая агрегация как принцип организации корковых сетей и функций человека. науч. Респ. 5, 18112.дои: 10.1038/srep18112

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Текин, Р., и Таглук, М.Е. (2017). Влияние вероятности перемонтажа маленького мира и шумовой синаптической проводимости на медленные волны: корковая сеть. Нейронные вычисления. 29, 679–715. дои: 10.1162/NECO_a_00932

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Телесфорд, К.К., Джойс, К.Е., Хаясака, С., Бердетт, Дж.Х., и Лауриенти, П.Дж. (2011). Повсеместное распространение сетей малого мира. Мозговой контакт. 1, 367–375. doi: 10.1089/мозг.2011.0038

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Цодыкс, М., Узиэль, А., и Маркрам, Х. (2000). Генерация синхроний в рекуррентных сетях с частотно-зависимыми синапсами. J. Neurosci. 20, RC50. doi: 10.1523/JNEUROSCI.20-01-j0003.2000

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Улхаас, П.Дж., и Сингер, В. (2006). Нейронная синхрония при заболеваниях головного мозга: актуальность для когнитивных дисфункций и патофизиологии. Нейрон 52, 155–168. doi: 10.1016/j.neuron.2006.09.020

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

фон Бартельд, К.С., Бани, Дж., и Эркулано-Хоузель, С. (2016). Поиск истинного количества нейронов и глиальных клеток в мозге человека: обзор 150-летнего подсчета клеток. Дж. Комп. Нейрол. 524, 3865–3895. doi: 10.1002/cne.24040

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Вуксанович, В.и Хёвель, П. (2014). Функциональная связность отдаленных областей коры: роль удаленной синхронизации и симметрии во взаимодействиях. Нейроизображение 97, 1–8. doi: 10.1016/j.neuroimage.2014.04.039

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ван, К., Перк, М., Дуань, З., и Чен, Г. (2010). Влияние задержек и перемонтажа на динамику нейронных сетей малого мира с двумя типами связи. Физ. Стат. мех. заявл. 389, 3299–3306.doi: 10.1016/j.physa.2010.03.031

Полнотекстовая перекрестная ссылка | Академия Google

Ветшорек Ф., Крабель Т. и Кришнамурти С. (2020). 8080labs/ppscore: выпуск zenodo . doi: 10.5281/zenodo.40

Полнотекстовая перекрестная ссылка

Вольфрам, С. (1984b). Универсальность и сложность клеточных автоматов. Physica D 10, 1–35. дои: 10.1016/0167-2789(84)-8

Полнотекстовая перекрестная ссылка | Академия Google

Ямамото, Х., Кубота С., Симидзу Ф. А., Хирано-Ивата А. и Нивано М. (2018). Эффективная топология подсети для синхронизации взаимосвязанных сетей связанных фазовых генераторов. Фронт. вычисл. Неврологи. 12, 17. doi: 10.3389/fncom.2018.00017

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Юань Б., Фанг Ю., Хань З., Сун Л., Хе Ю. и Би Ю. (2017). Мозговые центры в моделях поражения: прогнозирование топологии функциональной сети с характером поражения у пациентов. науч. 7, 17908.

Добавить комментарий

Ваш адрес email не будет опубликован.

2022 © Все права защищены.